home *** CD-ROM | disk | FTP | other *** search
/ MacFormat España 15 / macformat_15.iso / Presenting OMO™ / POMO / exhibits / wtherapp.sta (.txt) < prev   
UltraCard Stack  |  1995-08-04  |  5MB  |  21,644 lines
  1. BKGDregions
  2. ,BKGDus
  3. CRDHgreatlakes
  4. 0CRDHicons
  5. .CRDHnational
  6. CRDHnortheast
  7. -CRDHpacific
  8. CRDHsoutheast
  9.     CRDHmidatlantic
  10. ,CRDH
  11. -CRDH
  12. .CRDH
  13. /CRDH
  14. 0CRDH
  15. 6BKGD
  16. 1CRDH
  17. 2CRDH
  18. 0SCRP
  19. on foo
  20.   lock messages
  21.   put the script of btn "Help_backtomap" of cd "MidAtlantic" into sss
  22.   repeat with i = 11 to the number of cds
  23.     set the cursor to busy
  24.     go cd i
  25.     put i && the name of cd i
  26.     if not exists(btn "help_backtomap") then next repeat
  27.     set the script of btn "Help_backtomap" to sss
  28.     if not exists(cd snd "main") then
  29.       create cd snd
  30.       set the name of it to "main"
  31.       show it
  32.     end if
  33.   end repeat
  34. end foo
  35. on memtest
  36.   lock messages
  37.   repeat 6 times
  38.     answer objectsize(this cd) + objectsize(this bg)
  39.     go next cd
  40.   end repeat
  41. end memtest
  42. on putinNewData region, cities, offset
  43. --  global gWCdata
  44.   global gWCnumcitytotal
  45.   global gWCerror
  46.   put the number of rows of cities into numcityinreg
  47.   --breakpoint
  48.   repeat with i=1 to numcityinreg
  49.     lock screen
  50.     put word 1 of line i of cities into cityname
  51.     put word 3 of line i of cities into j
  52.     add 1 to j
  53.     do "put word" && (3+offset) && "of line" && j && "of bg fld WCData into cd fld" && quote & cityname  & quote && "of cd region"
  54.     do "put" && quote & "/" & quote && "after cd fld" && quote & cityname & quote && "of cd region"
  55.     do "put word" && (2+offset) && "of line" && j && "of bg fld WCData after cd fld" && quote & cityname & quote && "of cd region"
  56.      
  57.     do "put cd bmp" && quote & word (4+offset) of line j of bg fld "WCData" & quote && "of card Icons into cd bmp" && quote & cityname & "_icon" & quote && "of cd region"
  58.     unlock screen
  59.     show cd grp cityname
  60.   end repeat
  61. end putinNewData
  62. -------------------------
  63. -------------------------
  64. on openStack
  65.   --  global gWCusingSTB
  66.   --  global gWCwithMovie
  67.   global gNAVvscroll
  68.   global gNAVhscroll
  69.   --  global gNAVEpcotPath
  70.   --  global gNAVmoviepath
  71.   global gWCpath, gcursorNormal
  72.   set cursor to gcursorNormal
  73.   --if gWCusingSTB is "true" then
  74.   set the fullscreen to true
  75.   set the vertical scroll of card window to gNAVvscroll
  76.   set the horizontal scroll of card window to gNAVhscroll
  77.   --  end if
  78.   lock screen
  79.   go to cd "National"
  80.   hide cd pal "System"
  81.   hide cd pal "Custom"
  82.   --if gWCwithMovie is "false" then
  83.   unlock screen
  84.   stopmovie
  85.   --send disableNavBtn to card "National"
  86.   --initializeWC
  87.   --send openCard_call to card "National"
  88.   --put empty into gWCpath  
  89. end openStack
  90. -------------------------
  91. on closeStack
  92. --  global gWCwithMovie
  93.   --release cd mov "Intro" of cd "National"
  94.   lock screen
  95.   hide cd grp "Cities" of cd "National"
  96.   hide cd bmp "Wait" of cd "National"
  97.   hide cd fld "DayofWeek" of cd "National"
  98.   --show cd shape "Black_back" of cd "National"
  99.   --show cd bmp "Black_front" of cd "National"
  100.   unlock screen
  101.   --set the keyenabled of cd mov "Intro" of cd "National" to false
  102.   --realize cd pal "System" of cd "National"
  103.   --set the keyenabled of cd mov "Intro" of cd "National" to true
  104.   --show cd mov "Intro" of cd "National"
  105.   put (the number of bg timers of card "NorthEast") into numtimers
  106.   repeat with i=1 to numtimers
  107.     stop bg timer i of bg "Regions"
  108.   end repeat
  109.   put the number of cd timers of cd "National" into numtimers
  110.   repeat with i=1 to numtimers
  111.     stop cd timer i of cd "National"
  112.   end repeat
  113.   --put the number of bg alarms of bg "Regions" into numalarms
  114.   --repeat with i = 1 to numalarms
  115.   --  clear bg alarm i of bg "Regions"
  116.   --end repeat
  117.   --put the number of cd alarms of cd "National" into numalarms
  118.   --repeat with i = 1 to numalarms
  119.   --   clear cd alarm i of cd "National"
  120.   --end repeat
  121.   if exists(cd snd "main") then stop cd snd "main"
  122.   if exists(bg snd "main") then stop bg snd "main"
  123.   --play stop  
  124. end closeStack
  125. on endalarms
  126.   put the number of bg timers of cd "NorthEast" into numtimers
  127.   repeat with i=1 to numtimers
  128.     stop bg timer i of bg "Regions"
  129.   end repeat
  130.   put the number of cd timers of cd "National" into numtimers
  131.   repeat with i=1 to numtimers
  132.     stop cd timer i of cd "National"
  133.   end repeat
  134.   --put the number of bg alarms of bg "Regions" into numalarms
  135.   --repeat with i = 1 to numalarms
  136.   --  clear bg alarm i of bg "Regions"
  137.   --end repeat
  138.   --put the number of cd alarms of cd "National" into numalarms
  139.   --repeat with i = 1 to numalarms
  140.   -- clear cd alarm i of cd "National"
  141.   --end repeat
  142. end endalarms
  143. -------------------------
  144. on stopMovie
  145. --  global gNAVEpcotPath
  146. --  global gWCpath
  147. --  global gNAVcdev
  148. --  global gNAVmoviepath
  149. --  global gWCusingSTB
  150.   if gWCusingSTB is "true" then
  151.     import (gNAVmoviepath & "black.bkg") into cd "Black"
  152.   end if
  153.   send disableNavBtn to card "National"
  154.   initializeWC
  155.   --send openCard_call to card "National"
  156. end stopMovie
  157. -------------------------
  158. on initializeWC
  159.   setupScreen
  160.   setupVoices
  161.   setupVars
  162.   setupCities
  163.   --setupDays
  164.   --setupTrivia
  165. end initializeWC
  166. -------------------------
  167. on setupVars
  168.   global gWCnumcols
  169.   global gWCnumReg
  170.   global gWCcurrReg
  171.   global gWCerror
  172.   global gWCdate
  173.   global gWCplayedRegVoice
  174.   global gWCupReg
  175.   global gWCrightReg
  176.   global gWCdownReg
  177.   global gWCleftReg
  178.   global gWCacceptMouseClicks
  179.   global gWCacceptClickDelay
  180.   global gWCdemoShown
  181.   global gWCfirstTimeIn
  182.   global gWCalarmIsSet
  183.   put false into gWCerror
  184.   put 9 into gWCnumReg
  185.   put 1 into gWCcurrReg
  186.   put 16 into gWCnumcols
  187.   put gWCdate into cd fld "DayOfWeek"
  188.   --select line 1 of cd fld "DayOfWeek"
  189.   --set the textcolor of cd fld "DayOfWeek" to 182
  190.   --select empty
  191.   put 1 into gWCupReg
  192.   put 2 into gWCrightReg
  193.   put 3 into gWCdownReg
  194.   put 4 into gWCleftReg
  195.   put "false" into gWCplayedRegVoice
  196.   put "false" into gWCacceptMouseClicks
  197.   put 5 into gWCacceptClickDelay
  198.   put "false" into gWCdemoShown
  199.   put "true" into gWCfirstTimeIn
  200.   put "false" into gWCalarmIsSet
  201. end setupVars
  202. -------------------------
  203. on setupScreen
  204.   global gWCtoday
  205.   global gWCtomorrow
  206.   --hide cd mov "Intro"
  207.   -- set the keyenabled of cd mov "Intro" to false
  208.   --  realize cd pal "Custom"
  209.   -- set the keyenabled of cd mov "Intro" to true
  210.   lock screen
  211.   --hide cd shape "Black_back"
  212.   --hide cd bmp "Black_front"
  213.   show bg bmp "US"
  214.   show cd grp "National"
  215.   show cd bmp "Wait"
  216.   hide cd grp "Cities" of cd "National"
  217.   hide cd grp "National_hilite"
  218.   hide cd grp "National_hilite" of cd "National"
  219.   hide cd bmp "Trivia_hilite"
  220.   hide cd bmp "StartOver_hilite"
  221.   show cd bmp "Copyright"
  222.   show cd bmp "WCcopyright"
  223.   hide cd grp "Days_3"
  224.   --breakpoint
  225.   show cd bmp gWCtoday
  226.   hide cd bmp "Day1_hilite"
  227.   hide cd bmp "Day2_hilite"
  228.   hide cd bmp "Day3_hilite"
  229.   show cd bmp "Day1_hide"
  230.   hide cd bmp "Day2_hide"
  231.   hide cd bmp "Day3_hide"
  232.   hide cd btn "Day1"
  233.   show cd btn "Day2"
  234.   show cd btn "Day3"
  235.   hide cd fld "Keypress" of cd "National"
  236.   hide bg fld "Keypress" of bg "Regions"
  237.   hide bg grp "Day_bmps" of bg "Regions"
  238.   show bg bmp gWCtomorrow of bg "Regions"
  239.   unlock screen
  240. end setupScreen
  241. -------------------------
  242. on setupVoices
  243. --  global gNAVEpcotPath
  244.   global gWCpath
  245.   global gNAVcdev
  246.   global gWCtriviaVoice
  247.   global gWCvoicePath
  248.   global gWCmainVoice
  249.   global gWCmainMusic
  250.   global gWCregVoice
  251.   global gWCregMusic
  252.   global gWCselectVoice, gPathAudio
  253.   if the platform = "Windows" then put "\" into pSep
  254.   else put ":" into pSep
  255.   put "Audio"&pSep into gWCvoicePath
  256.   put "trivia.aif" into gWCtriviaVoice
  257.   put "Misc 21.1" into gWCselectVoice
  258.   if gNAVcdev is "REMOTE" then
  259.     put "RmtUSmix.aif" into gWCmainVoice
  260.     put "TchUSmsc.aif" into gWCmainMusic
  261.     put "RmtRgmix.aif" into gWCregVoice
  262.     put "TchRgmsc.aif" into gWCregMusic
  263.     start cd  timer "alarmVoice" of cd "National" expire in 4000 ticks
  264.     --ring cd alarm "alarmVoice" of cd "National" at 4000
  265.   else
  266.     put "TchUSmix.aif" into gWCmainVoice
  267.     put "TchUSmsc.aif" into gWCmainMusic
  268.     put "TchRgmix.aif" into gWCregVoice
  269.     put "TchRgmsc.aif" into gWCregMusic
  270.     start cd  timer "alarmVoice" of cd "National" expire in 4000 ticks    
  271.     --ring cd alarm "alarmVoice" of cd "National" at 2160
  272.   end if
  273.   -- set the soundFile of cd snd "main" to gPathAudio&gWCmainVoice
  274.   -- do "set the soundFile of cd snd main to"&&gPathAudio&gWCmainVoice
  275.   set the soundFile of cd snd "main" to gPathAudio&gWCmainVoice
  276.   play cd snd "main"
  277.   --play file (gNAVEpcotPath & gWCpath & gWCvoicePath & gWCmainVoice) nowait
  278. end setupVoices
  279. -------------------------
  280. on setupDays
  281.   global gWCtoday
  282.   global gWCtomorrow
  283.   global gWC1dayafter
  284.   global gWC2daysafter
  285.   put getNextDay(gWCtoday) into gWCtomorrow
  286.   put getNextDay(gWCtomorrow) into gWC1dayafter
  287.   put getNextDay(gWC1dayafter) into gWC2daysafter
  288. end setupDays
  289. -------------------------
  290. function getNextDay day
  291.   if day is Sunday then return Monday
  292.   if day is Monday then return Tuesday
  293.   if day is Tuesday then return Wednesday
  294.   if day is Wednesday then return Thursday
  295.   if day is Thursday then return Friday
  296.   if day is Friday then return Saturday
  297.   if day is Saturday then return Sunday
  298. end getNextDay
  299. -------------------------
  300. on setupCities
  301. --  global gWCnatcitiesInit
  302. --  global gWCnecitiesInit
  303. --  global gWCmacitiesInit
  304. --  global gWCsecitiesInit
  305. --  global gWCglcitiesInit
  306. --  global gWCnorcitiesInit
  307. --  global gWCcencitiesInit
  308. ---  global gWCsoucitiesInit
  309. --  global gWCnwcitiesInit
  310. --  global gWCswcitiesInit
  311. --  put "false" into gWCnatcitiesInit
  312. --  put "false" into gWCnecitiesInit
  313. --  put "false" into gWCmacitiesInit
  314. --  put "false" into gWCsecitiesInit
  315. --  put "false" into gWCglcitiesInit
  316. --  put "false" into gWCnorcitiesInit
  317. --  put "false" into gWCcencitiesInit
  318. --  put "false" into gWCsoucitiesInit
  319. --  put "false" into gWCnwcitiesInit
  320. --  put "false" into gWCswcitiesInit
  321. end setupCities
  322. -------------------------
  323. --on idle
  324. -- maybe use this time to populate the fields in other regions?
  325. --end idle
  326. -------------------------
  327. on setupTrivia
  328.   global gWCmonth
  329.   lock screen
  330.   put empty into cd fld Trivia
  331.   put empty into cd fld Trivia2
  332.   if gWCmonth is "January" then
  333.     put "1/22/1943: Spearfish, South Dakota recorded      the greatest two minute U.S. temperature rise when the temperature rose 49 degrees F, from -4 degrees F to 45 degrees F." into cd fld Trivia
  334.     put "1/28/1887: Snowflakes 
  335. larger than milkpans
  336. , measuring 15
  337.  across by 8
  338.  thick, reportedly fell near Fort Keogh, Montana." into cd fld Trivia2
  339.   else if gWCmonth is "February" then
  340.     put "2/11/1935: One associates hot temperatures with Africa, but Africa
  341. s all-time coldest temperature of -11 degrees F was set on this day in Ifrane, Morocco." into cd fld Trivia
  342.     put "2/13/1959: Mt. Shasta (Ski Bowl), California, set the North American record for a single snowstorm by measuring a storm total of 189
  343. ." into cd fld Trivia2
  344.   else if gWCmonth is "March" then
  345.     put "3/29/1848: An ice jam at the Niagara River between Fort Erie, Ontario and Buffalo,         New York caused the Niagara Falls to be     
  346. silent
  347.  for 30 hours." into cd fld Trivia
  348.     put "3/01/1990: A major storm hit Europe.  In Germany, the storm destroyed the amount of timber normally cut in one year." into cd fld Trivia2
  349.   else if gWCmonth is "April" then
  350.     put "4/6/1982: The opening season game between the Yankees and the Texas Rangers was postponed due to 12
  351.  of snow at Yankee Stadium in New York, NY." into cd fld Trivia
  352.     put "4/18/1973: Spring in Wyoming !  The 58
  353.  of snow which fell near Glenrock, Wyoming set the state's single storm snowfall record." into cd fld Trivia2
  354.   else if gWCmonth is "May" then
  355.     put "5/30/1951: Strange?!  After a tornado passed near Scottsbluff, Nebraska, a bean was found embedded 1
  356.  deep in the uncracked shell           of an egg." into cd fld Trivia
  357.     put "5/1/1980: A report from the Arabian Sea stated that ball lightning 
  358.            shaped like an orange fireball 
  359.  traveled horizontally over the sea." into cd fld Trivia2
  360.   else if gWCmonth is "June" then
  361.     put "6/26/1977: Roy C. Sullivan survived being      hit by lightning for the 7th time!                      His previous hits were in 1942, 1969, 1970, 1972, 1973 and 1976." into cd fld Trivia
  362.     put "06/30/68: For the first time               in June since 1892, not a single clear day was observed in           Sault Sainte Marie, Michigan." into cd fld Trivia2
  363.   else if gWCmonth is "July" then
  364.     put "7/4/1776: According to Thomas Jefferson
  365. s weather report, the first Independence Day      was cloudy with a temperature of                         76 degrees F at 2 pm." into cd fld Trivia
  366.     put "7/3/1892: In Liverpool, England, ball lightning fell into a lake, creating a column of water                60 feet high." into cd fld Trivia2
  367.   else if gWCmonth is "August" then
  368.     put "8/5/1924: One of the highest sea-surface temperatures was measured by the                      SS Frankenfels in the Persian Gulf.                       It measured 96 degrees F." into cd fld Trivia
  369.     put "8/20/1991: In South Dakota, a man drove for 10 minutes around 3:00 AM without headlights due to so much lightning!" into cd fld Trivia2
  370.   else if gWCmonth is "September" then
  371.     put "9/22/1989: Hurricane Hugo hit land near Charleston, South Carolina with winds of           140 mph.  Hugo was the second costliest          U.S. hurricane." into cd fld Trivia
  372.     put "9/13/1922: At El Azizia, Libya, the world's hottest temperature of 136 degrees F occurred . A severe ghibli (dust storm) was also in progress." into cd fld Trivia2
  373.   else if gWCmonth is "October" then
  374.     put "10/18/1911: The World Series game between           the Philadelphia A
  375. s and the N.Y. Giants was      rain delayed for 6 days 
  376.  the longest in      Series history." into cd fld Trivia
  377.     put "10/27/1972: A Crestview, Florida couple were awakened by rain falling on them 
  378.  a tornado had ripped the roof from their house !" into cd fld Trivia2
  379.   else if gWCmonth is "November" then
  380.     put "11/25/1950: In Columbus, Ohio, heavy snow           fell during the title game between Michigan          and Ohio State.  Brooms were needed to find      the yard markers !" into cd fld Trivia
  381.     put "11/8/1989: Strong winds behind a cold front (gusts to 50+ mph)           drifted tumbleweeds to 14' high          in parts of Mobridge, South Dakota." into cd fld Trivia2
  382.   else if gWCmonth is "December" then
  383.     put "12/9/1917: Vevay, Indiana reported 26
  384.                 of snow. After a week, people could walk           across the frozen Ohio River between Vevay           and Kentucky." into cd fld Trivia
  385.     put "12/27/1978: A new highest temperature for the South Pole (Antarctica) of 7.5 degrees F           was observed." into cd fld Trivia2
  386.   end if
  387.   select line 1 of cd fld "Trivia"
  388.   --set the textcolor of cd fld "Trivia" to 2
  389.   set the textcolor of cd fld "Trivia" to 121
  390.   set the textfont of cd fld "Trivia" to "EmigreFifTeen"
  391.   set the textstyle of cd fld "Trivia" to plain
  392.   set the textsize of cd fld "Trivia" to 24
  393.   set the textheight of cd fld "Trivia" to 24
  394.   select empty
  395.   select line 1 of cd fld "Trivia2"
  396.   set the textcolor of cd fld "Trivia2" to 121
  397.   set the textfont of cd fld "Trivia2" to EmigreFifTeen
  398.   set the textstyle of cd fld "Trivia2" to plain
  399.   set the textsize of cd fld "Trivia2" to 24
  400.   set the textheight of cd fld "Trivia2" to 24
  401.   select empty
  402.   unlock screen
  403. end setupTrivia
  404. -------------------------
  405. on countbmps
  406.   put empty into numbmps
  407.   put the number of cd bmps in cd "National" into numbmps
  408.   add the number of bg bmps in bg "US" to numbmps
  409.   add the number of cd bmps in cd "NorthEast" to numbmps
  410.   add the number of cd bmps in cd "MidAtlantic" to numbmps
  411.   add the number of cd bmps in cd "SouthEast" to numbmps
  412.   add the number of cd bmps in cd "GreatLakes" to numbmps
  413.   add the number of cd bmps in cd "North" to numbmps
  414.   add the number of cd bmps in cd "Central" to numbmps
  415.   add the number of cd bmps in cd "South" to numbmps
  416.   add the number of cd bmps in cd "NorthWest" to numbmps
  417.   add the number of cd bmps in cd "West" to numbmps
  418.   put the number of bg bmps in bg "Regions" into regbmps
  419.   multiply regbmps by 9
  420.   add regbmps to numbmps
  421.   put numbmps into msg box
  422. end countbmps
  423. -------------------------
  424. on stopDemo
  425.   repeat with i = 1 to the number of cd timers  
  426.     clear cd timer i
  427.   end repeat  
  428.   repeat with i = 1 to the number of bg timers  
  429.     clear bg timer i
  430.   end repeat
  431.   stop cd snd "main"
  432.   --  play stop
  433. end stopDemo
  434. on  showcdbmps
  435.   put the number of cd bmps into j
  436.   repeat with i = 1 to j
  437.     show cd bmp i
  438.   end repeat
  439. end showcdbmps
  440. on  showbgbmps
  441.   put the number of bg bmps into j
  442.   repeat with i = 1 to j
  443.     show bg bmp i
  444.   end repeat
  445. end showbgbmps
  446. PFONT
  447. APPLE CHANCERY
  448. ARIALF0
  449. ARIAL NARROW"t@
  450. ARIAL ROUNDED MT BOLD
  451. ATHENS
  452. AVANT GARDE
  453. B BAUERBODONI BOLD@
  454. B COURIER BOLDJ
  455. B FRUTIGER BOLD
  456. B FUTURA BOLDBJ
  457. B HELVETICA BOLDBBJ
  458. B ORCGARAM BOLD
  459. B TIMES BOLD
  460. BAUERBODONI
  461. BAUERBODONI BLACKF0
  462. BAUERBODONI BLACKCOND
  463. BAUERBODONI BLACKITALIC
  464. BAUERBODONI BOLDCOND;
  465. BAUHAUS 93
  466. BI BAUERBODONI BOLDITALIC
  467. BI COURIER BOLDOBLIQUE
  468. BI FRUTIGER BOLDITALIC
  469. BI HELVETICA BOLDOBLIQUE"t@
  470. BI TIMES BOLDITALIC
  471. BO FUTURA BOLDOBLIQUE9R
  472. BODONI BD BT;
  473. BODONI BDIT BT 
  474.     BODONI BTF0
  475. BODONI IT BT"t@
  476. BOOK ANTIQUA!
  477. BOOKMAN
  478. BOOKMAN OLD STYLE
  479. BOOKMAN OLD STYLE BOLD
  480. BRAGGADOCIO
  481. BRITANNIC BOLD
  482. BRUSH SCRIPT6F0
  483. BRUSH SCRIPT MT
  484. C FUTURA CONDENSED@
  485. C HELVETICA CONDENSEDJ!
  486. C UNIVERS 57 CONDENSED!
  487. CAIRO
  488. CB FUTURA CONDENSEDBOLD
  489. CB HELVETICA CONDENSED BOLD
  490. CB UNIVERS 67 CONDENSEDBOLD
  491. CBI HELVETICA CONDENSED BOLDOBL
  492. CBO FUTURA CONDBOLDOBLIQUE
  493. CBO UNIVERS 67 CONDBOLDOBL
  494. CENTURY GOTHIC
  495. CENTURY SCHOOLBOOK
  496. CHICAGO
  497. CI HELVETICA CONDENSED OBLIQUE
  498. CITIZENBOLD
  499. CITIZENLIGHT
  500. CL FUTURA CONDENSEDLIGHT1J
  501. CL HELVETICA CONDENSED LIGHT"t@
  502. CL UNIVERS 47 CONDENSEDLIGHTJc{
  503. CLB HELVETICA CONDENSED BLACKZs
  504. CLBI HELVETICA CONDENSED BLACKO
  505. CLI HELVETICA CONDENSED LIGHTOB
  506. CLO FUTURA CONDLIGHTOBLIQUE
  507. CLO UNIVERS 47 CONDLIGHTOBL
  508. CO FUTURA CONDENSEDOBLIQUE{
  509. CO UNIVERS 57 CONDOBLIQUEt@
  510. COLONNA MT
  511. COMMERCIALPI BT
  512. COURIER
  513. COURIER NEW
  514. CXB FUTURA CONDEXTRABOLD
  515. CXBO FUTURA CONDEXTRABOLDOBLIQU
  516.     DESDEMONA
  517. EMIGREEIGHT
  518. EMIGREFIFTEENt@
  519. EMIGREFOURTEEN
  520.     EMIGRETEN
  521.     ESPY SANS
  522. ESPY SANS BOLD
  523. ESPY SERIF@
  524. ESPY SERIF BOLD
  525. FIXEDSYS
  526. FOOTLIGHT MT LIGHT
  527. FRANKFURTERMEDIUM
  528. FUTURA
  529. FUTURA BD BT6F0
  530. FUTURA BDIT BT@
  531. FUTURA BK BTk
  532. FUTURA BKIT BT
  533. FUTURA BOOK
  534. FUTURA MD BT
  535. FUTURA MDIT BT
  536. GENEVA
  537. GENEVA
  538. GILLSANS
  539. GILLSANS BOLDF0
  540. GILLSANS BOLDITALIC
  541. GILLSANS ITALIC
  542. GOUDY TEXT MT
  543. H FUTURA HEAVY
  544.     HELVETICA
  545. HO FUTURA HEAVYOBLIQUE
  546. HOEFLER TEXT;
  547. HOEFLER TEXT ORNAMENTS
  548. I BAUERBODONI ITALIC
  549. I COURIER OBLIQUE
  550. I FRUTIGER ITALIC
  551. I HELVETICA OBLIQUE
  552. I ORCGARAM LIGHTITALIC1
  553. I TIMES ITALIC1
  554. IMPACT 
  555. IMPRESS BT0
  556. KINO MT
  557. L FRUTIGER LIGHT
  558. L FUTURA LIGHT
  559. LI FRUTIGER LIGHTITALIC
  560. LO FUTURA LIGHTOBLIQUE
  561. LONDON
  562. LOS ANGELES
  563. MATURA MT SCRIPT CAPITALS
  564. MISTRAL
  565. MOBILE
  566. MODULASERIF
  567. MODULASERIFBLACK;
  568. MODULASERIFBOLD
  569. MONACO@
  570. MONOTYPE CORSIVA"t@
  571. MONOTYPE SORTS)
  572. MS LINEDRAW
  573. MS SERIF
  574. MT EXTRA6F0
  575. N HELVETICA NARROW0
  576. NEW CENTURY SCHLBK0
  577. NEW YORK
  578. O FUTURA BOOKOBLIQUE"t@
  579. O FUTURA OBLIQUE"t@
  580. OCR-A
  581. ORCGARAM
  582. PALATINO6F0
  583. PLAYBILL
  584. PROFONT
  585.     QUICKTYPE
  586. QUICKTYPE CONDENSED
  587. QUICKTYPE MONO0
  588. QUICKTYPE PI"t@
  589. R 2MODFRUTIGER ROMANJc{
  590. R FRUTIGER ROMAN1J
  591. SAN FRANCISCO
  592. SKIA6F0
  593. SMALL FONTS
  594. STENCIL
  595. SYMBOL0
  596. TEKTON PLUS REGULAR
  597. TIMES{
  598. TIMES NEW ROMAN
  599. TORONTO
  600. TRADEGOTHIC-BOLDCONDTWENTY
  601. TRADEGOTHIC-BOLDCONDTWENTYOBLc{
  602. VENICE
  603. VIVALDI
  604. WIDE LATIN
  605.     WINGDINGSc{
  606. XB FUTURA EXTRABOLD
  607. XBO FUTURA EXTRABOLDOBLIQUE
  608. ZAPF CHANCERY
  609. ZAPF DINGBATS
  610. ZAPFHUMNST BD BT
  611. ZAPFHUMNST BDIT BT
  612. ZAPFHUMNST BT
  613. ZAPFHUMNST IT BT;
  614. ZAPFHUMNST ULT BT
  615. ZAPFHUMNST ULTIT BTIDMO
  616. 0IDBK
  617. .IDCD
  618. /TAIL
  619. 1INFO
  620. /TAIL
  621. 2INFO
  622. USSCRP
  623. on mouseHasBeenClicked
  624.   --clearIdleAlarm
  625.   repeat with i = 1 to the number of cd timers  
  626.     stop cd timer i
  627.   end repeat
  628.   --repeat with i = 1 to the number of cd alarms  
  629.   --  clear cd alarm i
  630.   --end repeat
  631.   --play stop
  632.   --stop cd snd "main"
  633.   if the visible of cd btn "Continue" is "true" then
  634.     send dismissPopup to cd btn "Continue"
  635.   end if
  636. end mouseHasBeenClicked
  637. -------------------------
  638. on keyPressed theKey
  639.   global gWChilitedReg
  640.   global gNAVcdev
  641.   global gWCinitialReg
  642.   global gWCreg_or_btn
  643.   global gWCacceptMouseClicks
  644.   --  global gNAVEpcotPath
  645.   global gWCpath
  646.   global gWCvoicePath
  647.   global gWCmainMusic, gPathAudio
  648.   if gNAVcdev is "REMOTE" then
  649.     --clearIdleAlarm
  650.     if gWCacceptMouseClicks is not "false" then
  651.       if (theKey is "r") then
  652.         if gWCreg_or_btn is "region" then
  653.           put the rightregion of cd bmp gWChilitedReg into gotoregion
  654.           checkReg_cd gotoregion
  655.         else
  656.           put the rightbutton of cd btn gWChilitedReg into gotoregion
  657.           if gotoregion is not empty then
  658.             if the visible of cd btn gotoregion is false then
  659.               put the rightbutton of cd btn gotoregion into gotoregion
  660.             end if
  661.           end if
  662.           checkReg_btn gotoregion
  663.         end if
  664.         select char 1 of cd fld "Keypress"
  665.       else if (theKey is "l") then
  666.         if gWCreg_or_btn is "region" then
  667.           put the leftregion of cd bmp gWChilitedReg into gotoregion
  668.           checkReg_cd gotoregion
  669.         else
  670.           put the leftbutton of cd btn gWChilitedReg into gotoregion
  671.           if gotoregion is not empty then
  672.             if the visible of cd btn gotoregion is false then
  673.               put the leftbutton of cd btn gotoregion into gotoregion
  674.             end if
  675.           end if
  676.           checkReg_btn gotoregion
  677.         end if
  678.         select char 1 of cd fld "Keypress"
  679.       else if (theKey is "u") then
  680.         if gWCreg_or_btn is "region" then
  681.           put the upregion of cd bmp gWChilitedReg into gotoregion
  682.           if word 1 of gotoregion is "Button" then
  683.             put "button" into gWCreg_or_btn
  684.             do "hide cd bmp" && quote & gWChilitedReg & "_hilite" & quote
  685.             send mouseDown to cd btn (word 2 of gotoregion)
  686.             put (word 2 of gotoregion) into gWChilitedReg
  687.           else
  688.             checkReg_cd gotoregion
  689.           end if
  690.         else
  691.           if the upregion of cd btn gWChilitedReg is not empty then
  692.             put "region" into gWCreg_or_btn
  693.             send mouseLeave to cd btn gWChilitedReg
  694.             put the upregion of cd btn gWChilitedReg into gWChilitedReg
  695.             do "show cd bmp" && quote & gWChilitedReg & "_hilite" & quote
  696.           else
  697.             beep
  698.           end if
  699.         end if
  700.         select char 1 of cd fld "Keypress"
  701.       else if (theKey is "d") then
  702.         if gWCreg_or_btn is "region" then
  703.           put the downregion of cd bmp gWChilitedReg into gotoregion
  704.           if word 1 of gotoregion is "Button" then
  705.             put "button" into gWCreg_or_btn
  706.             do "hide cd bmp" && quote & gWChilitedReg & "_hilite" & quote
  707.             put word 2 of gotoregion into gotobtn
  708.             if the visible of cd btn gotobtn is false then
  709.               put word 3 of gotoregion into gotobtn
  710.             end if
  711.             send mouseDown to cd btn gotobtn
  712.             put gotobtn into gWChilitedReg
  713.           else
  714.             checkReg_cd gotoregion
  715.           end if
  716.         else
  717.           if gWChilitedReg is "Continue" then
  718.             --clear cd alarm "alarmGoBack"
  719.             stop cd timer "alarmGoBack"
  720.             --play stop
  721.             stop cd snd "main"
  722.             lock screen
  723.             send mouseLeave to cd btn "Continue"
  724.             hide cd grp "Months"
  725.             hide cd btn "Continue"
  726.             unlock screen
  727.             put "Trivia" into gWChilitedReg
  728.             send mouseDown to cd btn "Trivia"
  729.             --ring cd alarm "alarmSelect" at 2100
  730.             start cd timer "alarmSelect" expire in 2100
  731.             --play file (gNAVEpcotPath & gWCpath & gWCvoicePath & gWCmainMusic) nowait
  732.             set the soundFile of cd snd "main" to 
  733.                 (gPathAudio & gWCmainMusic)
  734.             set the bufferSize of cd snd "main" to 180
  735.             set the playVolume of cd snd "main" to 100
  736.             
  737.             play cd snd "main"
  738.           else
  739.             if the downregion of cd btn gWChilitedReg is not empty then
  740.               put "region" into gWCreg_or_btn
  741.               send mouseLeave to cd btn gWChilitedReg
  742.               put the downregion of cd btn gWChilitedReg into gWChilitedReg
  743.               do "show cd bmp" && quote & gWChilitedReg & "_hilite" & quote
  744.             else
  745.               beep
  746.             end if
  747.           end if
  748.         end if
  749.         select char 1 of cd fld "Keypress"
  750.       else if (theKey is "s") then
  751.         if gWCreg_or_btn is "region" then
  752.           --put "s" && gWChilitedReg && " " after the message box
  753.           send mouseUp to cd bmp gWChilitedReg
  754.         else
  755.           send mouseLeave to cd btn gWChilitedReg
  756.           send mouseUp to cd btn gWChilitedReg
  757.         end if
  758.       else if (theKey is "q") then
  759.         if gWCreg_or_btn is "region" then
  760.           send mouseLeave to cd bmp gWChilitedReg
  761.         else
  762.           send mouseLeave to cd btn gWChilitedReg
  763.         end if
  764.         send mouseUp to cd btn "StartOver"
  765.       end if
  766.     end if    
  767.   end if
  768.   --pass keyPressed theKey
  769. end keyPressed
  770. -------------------------
  771. on checkReg_cd gotoregion
  772.   global gWChilitedReg
  773.   if gotoregion is not empty then
  774.     do "hide cd bmp" && quote & gWChilitedReg & "_hilite"
  775.     do "show cd bmp" && quote & gotoregion & "_hilite"
  776.     put gotoregion into gWChilitedReg
  777.   else
  778.     beep
  779.   end if
  780. end checkReg_cd
  781. -------------------------
  782. on checkReg_btn gotoregion
  783.   global gWChilitedReg
  784.   if gotoregion is not empty then
  785.     send mouseLeave to cd btn gWChilitedReg
  786.     send mouseDown to cd btn gotoregion
  787.     put gotoregion into gWChilitedReg
  788.   else
  789.     beep
  790.   end if
  791. end checkReg_btn
  792. -------------------------
  793. --on idle
  794.   --setIdleAlarm
  795. --end idle
  796. -------------------------
  797. on setIdleAlarm
  798.   global gWCalarmIsSet
  799.   if gWCalarmIsSet is "false" then
  800.     put "true" into gWCalarmIsSet
  801.     --ring cd alarm "idle_alarm" at 4200
  802.     --start cd timer "idle_alarm" expire in 4200
  803.   end if
  804. end setIdleAlarm  
  805. -------------------------
  806. on clearIdleAlarm
  807.   global gWCalarmIsSet
  808.   put "false" into gWCalarmIsSet
  809.   --clear cd alarm "idle_alarm"
  810.   --stop cd timer "idle_alarm"
  811. end clearIdleAlarm
  812. -------------------------
  813. on regionBitmapPush thisregion
  814.   global gWCacceptMouseClicks
  815.   if gWCacceptMouseClicks is not "false" then
  816.     stop cd snd "main"
  817.     mouseHasBeenClicked
  818.     hide cd grp "Cities" of cd thisregion
  819.     do "hide cd bmp" && quote & thisregion & "_hilite" & quote
  820.     do "show cd bmp" && quote & thisregion & "_hilite" & quote 
  821.     do "hide cd bmp" && quote & thisregion & "_hilite" & quote
  822.     do "show cd bmp" && quote & thisregion & "_hilite" & quote 
  823.     go to card thisregion
  824.   end if
  825. end regionBitmapPush
  826. --------------------------
  827. on regionBitmapDown thisregion
  828.   global gWCacceptMouseClicks
  829.   if gWCacceptMouseClicks is not "false" then
  830.     do "show cd bmp" && quote & thisregion & "_hilite" & quote 
  831.   end if
  832. end regionBitmapDown
  833. --------------------------
  834. on regionBitmapLeave thisregion
  835.   do "hide cd bmp" && quote & thisregion & "_hilite" & quote
  836. end regionBitmapLeave
  837. -------------------------
  838. on cdbuttonDown btnname
  839.   global gWCacceptMouseClicks
  840.   if gWCacceptMouseClicks is not "false" then
  841.     do "show cd bmp" && quote & btnname & "_hilite" & quote 
  842.   end if
  843. end cdbuttonDown
  844. -------------------------
  845. on cdbuttonLeave btnname
  846.   do "hide cd bmp" && quote & btnname & "_hilite" & quote
  847. end cdbuttonLeave
  848. --------------------------
  849. on enableNavBtn
  850.   enable cd btn "StartOver"
  851.   enable cd btn "Trivia"
  852.   enable cd btn "Day1"
  853.   enable cd btn "Day2"
  854.   enable cd btn "Day3"
  855.   enable cd btn "Help"
  856. end enableNavBtn
  857. -------------------------
  858. on disableNavBtn
  859.   disable cd btn "StartOver"
  860.   disable cd btn "Trivia"
  861.   disable cd btn "Day1"
  862.   disable cd btn "Day2"
  863.   disable cd btn "Day3"
  864.   disable cd btn "Help"
  865. end disableNavBtn
  866. -------------------------
  867. on closeCard
  868.   global gWChilitedReg
  869.   global gNAVcdev
  870.   global gWCreg_or_btn
  871.   global gWCwhichday
  872.   global gWCnatcitiesInit
  873.   stop cd snd "main"
  874.   lock screen
  875.   --mouseHasBeenClicked
  876.   hide cd bmp "Copyright"
  877.   hide cd bmp "WCcopyright"
  878.   if gNAVcdev is "REMOTE" then
  879.     if gWCreg_or_btn is "region" then
  880.       send mouseLeave to cd bmp gWChilitedReg
  881.     else
  882.       send mouseLeave to cd btn gWChilitedReg
  883.     end if
  884.   end if
  885.   hide cd grp "National_hilite"
  886.   hide cd fld "DayofWeek"
  887.   if gWCwhichDay is not "today" then
  888.     put "false" into gWCnatcitiesInit
  889.   end if
  890.   select empty
  891.   unlock screen
  892. end closeCard
  893. -------------------------
  894. on demohilite
  895.   global gNAVcdev
  896.   show cd bmp "Day2_hilite"
  897.   show cd bmp "Day2_hilite"
  898.   show cd bmp "Day2_hilite"
  899.   show cd bmp "Day2_hilite"
  900.   hide cd bmp "Day2_hilite"
  901.   show cd bmp "Day3_hilite"
  902.   show cd bmp "Day3_hilite"
  903.   show cd bmp "Day3_hilite"
  904.   show cd bmp "Day3_hilite"
  905.   hide cd bmp "Day3_hilite"
  906.   show cd bmp "Trivia_hilite"
  907.   show cd bmp "Trivia_hilite"
  908.   show cd bmp "Trivia_hilite"
  909.   show cd bmp "Trivia_hilite"
  910.   hide cd bmp "Trivia_hilite"
  911.   show cd bmp "SouthEast_hilite"
  912.   hide cd bmp "SouthEast_hilite"
  913.   show cd bmp "MidAtlantic_hilite"
  914.   hide cd bmp "MidAtlantic_hilite"
  915.   show cd bmp "NorthEast_hilite"
  916.   hide cd bmp "NorthEast_hilite"
  917.   show cd bmp "GreatLakes_hilite"
  918.   hide cd bmp "GreatLakes_hilite"
  919.   show cd bmp "Central_hilite"
  920.   hide cd bmp "Central_hilite"
  921.   show cd bmp "North_hilite"
  922.   hide cd bmp "North_hilite"
  923.   show cd bmp "NorthWest_hilite"
  924.   hide cd bmp "NorthWest_hilite"
  925.   show cd bmp "West_hilite"
  926.   hide cd bmp "West_hilite"
  927.   show cd bmp "South_hilite"
  928.   hide cd bmp "South_hilite"
  929.   show cd bmp "Day3_hilite"
  930.   show cd bmp "Day3_hilite"
  931.   show cd bmp "Day3_hilite"
  932.   show cd bmp "Day3_hilite"
  933.   hide cd bmp "Day3_hilite"
  934.   show cd bmp "Day2_hilite"
  935.   show cd bmp "Day2_hilite"
  936.   show cd bmp "Day2_hilite"
  937.   show cd bmp "Day2_hilite"
  938.   if gNAVcdev is not "REMOTE" then
  939.     hide cd bmp "Day2_hilite"
  940.   end if
  941. end demohilite
  942. USEXTI
  943. wcDataEXTI
  944. 95/6/10 13.55                                                            
  945. ABQ    40    62    B    38    55    MTSVR    40    52    SCSSW    32    54    SUN    31    59    SUN
  946. ABR    35    55    U    35    54    SCSW    35    45    AMRS    25    45    SUN    25    45    SUN
  947. ACY    35    57    E    34    57    SUN    36    64    SUN    46    64    VCLDY    49    63    SHW
  948. ALB    26    52    N    26    52    SUN    36    56    PC    37    56    SCSW    46    53    SHW
  949. ALO    31    55    U    42    57    SCSW    45    57    SHW    35    45    PC    26    47    SUN
  950. AMA    35    59    U    43    59    PMTRW    45    56    AMSHW    35    56    SUN    32    63    SUN
  951. APN    21    46    U    35    55    PC    44    56    SHW    44    52    SHW    35    44    WNDY
  952. ATL    52    69    R    45    66    PC    46    66    PC    55    75    SCSW    48    65    AMSHW
  953. BGR    25    48    N    25    49    PC    30    53    PC    37    56    VCLDY    45    54    SHW
  954. BHM    54    67    W    48    73    PC    49    73    PC    55    74    SCTRW    47    65    AMSHW
  955. BIS    33    55    U    35    47    SCSW    26    44    PC    25    44    SUN    25    45    PC
  956. BNA    44    63    C    45    65    PC    47    72    PC    54    65    SCSW    44    57    PC
  957. BNO    20    37    J    26    44    VCLDY    17    43    PC    18    43    PC    25    44    MTSVR
  958. BOI    36    49    W    30    44    SSHW    23    43    SUN    22    44    SUN    21    44    SCSW
  959. BOS    29    51    B    32    55    SUN    35    59    PC    43    62    VCLDY    47    56    SHW
  960. BRL    34    55    U    44    64    VCLDY    45    64    SHW    42    52    PC    33    53    SUN
  961. BRO    60    74    E    65    85    PC    65    85    SCTRW    71    83    SCTRW    55    74    PC
  962. BTV    25    44    j    24    47    PC    35    55    VCLDY    36    55    SHW    45    46    SHW
  963. BUF    30    49    B    31    55    SUN    43    63    SPMSW    45    56    SHW    45    46    WNDY
  964. BZN    21    39    E    25    34    RS    15    38    SUN    15    42    SUN    21    37    VCLDY
  965. CAE    49    80    W    40    65    PC    43    65    PC    47    74    PC    54    66    AMSHW
  966. CAR    25    39    j    24    45    PC    26    46    PC    35    55    SCSW    45    54    SHW
  967. CHA    46    66    W    44    66    PC    45    66    PC    54    72    SCSW    45    60    PC
  968. CHS    55    83    W    46    65    PC    46    65    PC    52    75    PC    63    73    SCTRW
  969. CLE    30    54    B    35    63    SUN    44    64    SPMSW    45    62    SHW    43    53    WNDY
  970. CLT    43    71    W    36    65    SUN    37    65    PC    46    69    VCLDY    47    65    AMSHW
  971. COS    34    58    B    33    54    SCSW    25    43    AMSHW    24    46    SUN    24    54    SUN
  972. CSG    55    75    T    48    69    PC    48    70    PC    55    75    SCSW    55    66    AMSHW
  973. CVG    34    57    B    40    65    SUN    45    65    VCLDY    54    63    SHW    36    55    PC
  974. CYS    32    57    B    34    52    SCSW    24    39    AMSHW    23    44    SUN    24    53    SUN
  975. DCA    36    60    E    32    56    SUN    36    64    SUN    46    65    VCLDY    46    58    SHW
  976. DEN    34    56    B    34    54    SCSW    25    43    AMSHW    24    47    SUN    24    54    SUN
  977. DFW    42    63    U    54    74    VCLDY    60    74    SHW    49    65    AMSHW    37    65    SUN
  978. DLH    29    47    U    35    55    SCSW    37    46    SHW    32    37    PC    26    43    PC
  979. DRT    45    67    U    55    76    SCSW    62    74    SCTRW    52    66    AMSHW    42    65    SUN
  980. DSM    35    55    U    44    60    SCSW    45    57    SHW    34    46    PC    26    54    SUN
  981. DTW    29    52    U    35    62    PC    45    64    SCSW    45    55    SHW    42    48    WNDY
  982. ELP    46    70    B    44    64    SCSW    44    64    PC    36    64    SUN    35    64    SUN
  983. ELY    18    43    J    19    39    SSHW    19    38    SUN    15    46    SUN    18    49    PC
  984. EUG    34    48    B    35    46    VCLDY    32    44    SCSW    35    46    R    35    44    SHW
  985. EWR    35    56    B    29    56    SUN    35    61    SUN    45    63    VCLDY    47    56    SHW
  986. EYW    75    85    B    74    85    ISTRW    74    85    PC    74    85    ISTRW    74    85    ISTRW
  987. FAR    35    54    U    35    54    SCSW    35    45    AMRS    25    44    SUN    25    45    SUN
  988. FAT    45    56    W    44    56    VCLDY    36    63    PC    36    64    PC    44    63    SCSW
  989. FLG    28    49    N    30    51    SHW    32    52    PC    19    50    SUN    26    56    PC
  990. FMY    67    88    B    67    84    PC    66    84    PC    67    85    ISTRW    66    84    ISTRW
  991. FSD    35    55    U    35    55    SCSW    39    47    AMRS    25    45    SUN    25    48    SUN
  992. FWA    29    55    U    36    64    PC    45    65    SCSW    46    55    SHW    36    47    PC
  993. GCK    35    56    U    36    56    PMTRW    39    54    AMSHW    33    55    SUN    25    55    SUN
  994. GDV    28    54    B    26    45    SCSW    25    42    PC    24    45    SUN    25    45    PC
  995. GEG    26    40    LCW    25    39    VCLDY    25    37    PC    25    43    PC    26    40    MTSVR
  996. GFK    33    53    U    35    53    SCSW    35    44    AMRS    25    42    SUN    25    44    PC
  997. GJT    39    60    E    32    50    RS    31    46    PC    22    44    SUN    22    52    PC
  998. GTF    27    47    E    27    35    RS    23    43    SUN    23    43    PC    24    43    VCLDY
  999. HOU    47    67    E    58    76    PC    64    82    SCSW    64    73    SCTRW    46    66    PC
  1000. IND    31    56    U    42    65    PC    45    65    SCSW    52    56    SHW    35    52    PC
  1001. INL    30    46    U    35    55    SCSW    35    45    SHW    26    36    PC    25    37    PC
  1002. ISN    33    55    U    27    45    SCSW    25    37    PC    25    45    SUN    25    45    PC
  1003. JAX    64    84    B    55    67    FSHW    55    74    PC    59    77    PC    64    75    SCTRW
  1004. LAS    42    59    LCW    42    63    PC    45    63    PC    39    65    SUN    41    65    PC
  1005. LAX    55    64    W    48    63    PC    53    62    PC    55    71    PC    52    73    PC
  1006. LBB    36    65    U    45    62    PMTRW    45    62    AMSHW    36    59    SUN    34    64    SUN
  1007. LBF    35    55    U    35    55    SCSW    34    46    AMSHW    25    47    SUN    18    55    SUN
  1008. LEX    35    60    E    43    65    SUN    46    66    PC    54    65    SHW    38    55    PC
  1009. LIT    45    58    E    54    74    PC    55    74    SCSW    54    65    SCSW    37    65    PC
  1010. LSE    28    54    U    36    55    SCSW    45    55    SHW    35    44    PC    26    45    PC
  1011. LWS    36    44    LCW    26    44    VCLDY    24    43    SUN    27    44    PC    27    44    SCSW
  1012. MAF    39    65    U    45    65    PMTRW    49    65    PC    41    64    PC    35    64    SUN
  1013. MCI    40    55    U    45    64    SCSW    47    63    SHW    36    55    PC    33    55    SUN
  1014. MEM    45    63    C    54    73    PC    54    74    VCLDY    55    65    SCSW    44    64    PC
  1015. MIA    74    85    B    74    85    ISTRW    73    85    FSHW    74    85    ISTRW    73    85    ISTRW
  1016. MLS    29    54    B    26    45    SCSW    25    44    PC    23    45    SUN    25    45    PC
  1017. MOB    61    77    T    56    74    PC    59    75    PC    64    75    SCTRW    55    68    AMSHW
  1018. MQT    26    46    U    35    55    VCLDY    43    54    SHW    35    36    AMRS    35    41    WNDY
  1019. MSP    32    51    U    35    55    SCSW    44    48    SHW    28    44    PC    25    45    SUN
  1020. MTN    34    59    E    31    56    SUN    36    63    SUN    46    65    VCLDY    46    58    SHW
  1021. NEW    59    76    T    58    75    PC    64    76    PC    64    75    SCTRW    55    68    AMSHW
  1022. NGP    51    73    B    64    84    PC    65    84    SCTRW    65    75    SCTRW    52    72    PC
  1023. OMA    35    55    U    43    56    SCSW    44    55    SHW    27    47    SUN    26    54    SUN
  1024. ORD    31    55    U    40    64    PC    45    64    SHW    45    52    SHW    35    46    PC
  1025. ORF    43    64    LCW    37    64    PC    40    65    SUN    51    68    PC    54    66    SHW
  1026. ORL    65    86    B    65    81    FSHW    64    77    PC    65    84    ISTRW    65    80    SCTRW
  1027. PAH    41    63    E    47    65    PC    54    74    SPMSW    54    63    SCSW    37    56    PC
  1028. PDX    37    50    B    33    45    VCLDY    32    44    SCSW    35    45    R    35    43    SHW
  1029. PFN    62    79    LCT    56    75    PC    58    75    PC    64    77    SCSW    56    74    SCTRW
  1030. PFN    no data        no data    no data    56    75    PC    58    75    PC    64    76    SCTRW    56    73
  1031. PHL    34    57    B    32    56    SUN    36    63    SUN    45    64    VCLDY    46    59    SHW
  1032. PHX    51    73    N    48    64    AMSHW    48    67    PC    47    72    SUN    50    76    PC
  1033. PIH    32    48    W    21    41    MTSVR    15    40    SUN    19    42    SUN    21    43    VCLDY
  1034. PIR    38    55    U    35    54    SCSW    31    45    PC    25    45    SUN    24    49    SUN
  1035. PIT    29    53    B    31    61    SUN    41    63    PC    45    64    SHW    45    55    PC
  1036. PSP    50    71    LCW    52    70    PC    53    71    PC    51    72    SUN    50    75    PC
  1037. PWM    26    50    N    26    53    PC    33    55    PC    39    56    VCLDY    45    54    SHW
  1038. RAP    36    59    U    33    53    SCSW    25    43    PC    24    45    SUN    23    52    SUN
  1039. RDU    37    69    LCW    35    64    SUN    36    65    SUN    46    73    PC    49    65    SHW
  1040. RIC    35    61    LCW    34    59    SUN    36    65    SUN    46    68    VCLDY    46    63    SHW
  1041. RKS    28    49    N    20    40    S    22    38    SCSSW    19    39    SUN    19    45    PC
  1042. RNO    29    40    J    24    42    VCLDY    23    42    SUN    22    47    PC    26    43    VCLDY
  1043. ROA    36    62    LCW    28    60    SUN    36    64    SUN    46    66    PMSHW    45    61    AMSHW
  1044. SAC    42    55    W    44    61    VCLDY    36    61    PC    35    63    PC    44    55    SCSW
  1045. SAN    54    64    W    48    66    PC    54    65    PC    54    74    PC    53    75    PC
  1046. SAT    47    71    U    57    81    VCLDY    64    76    SCTRW    57    67    SCSW    45    65    PC
  1047. SAV    60    82    LCW    50    66    PC    47    66    PC    55    75    PC    63    74    SCTRW
  1048. SEA    37    49    B    31    42    VCLDY    29    43    SCSW    34    42    R    34    42    SHW
  1049. SFO    45    58    W    49    64    VCLDY    47    64    PC    43    64    PC    44    63    SCSW
  1050. SGF    40    56    B    46    65    VCLDY    54    67    SHW    45    55    AMSHW    35    57    SUN
  1051. SHR    29    54    B    26    44    SCSW    21    42    PC    14    44    SUN    21    45    PC
  1052. SHV    45    62    E    55    74    PC    62    75    SCSW    56    66    SCSW    45    65    PC
  1053. SLC    35    60    W    27    42    RS    22    39    PC    20    41    SUN    21    43    PC
  1054. SSI    61    84    W    54    66    PC    50    71    PC    56    76    PC    64    75    SCTRW
  1055. SSM    24    46    U    35    55    PC    42    55    SHW    37    42    AMRS    35    37    WNDY
  1056. STL    42    56    B    47    65    PC    52    71    SHW    51    55    AMSHW    35    55    SUN
  1057. SUX    35    55    U    39    55    SCSW    43    53    SHW    26    46    SUN    25    54    SUN
  1058. SYR    29    47    N    26    55    SUN    37    57    VCLDY    44    56    SHW    45    46    WNDY
  1059. TOP    36    55    U    45    64    SCSW    47    60    SHW    35    55    PC    33    55    SUN
  1060. TPH    24    45    LCW    31    46    VCLDY    31    45    SUN    25    52    SUN    27    57    PC
  1061. TRI    37    63    W    34    65    SUN    38    65    PC    47    66    SCSW    45    57    PC
  1062. TUL    45    54    U    51    65    VCLDY    54    66    SHW    43    56    AMSHW    35    63    SUN
  1063. UIL    35    46    B    38    47    VCLDY    41    44    SCSW    40    44    R    38    44    SHW
  1064.  TAIL
  1065. 6INFO
  1066. IconsSCRP
  1067. on openCard
  1068. end openCard
  1069. -------------------------
  1070. on closeCard
  1071. end closeCard
  1072. hGRPO
  1073. ]CARD
  1074. iconsdata
  1075. Iconsdata
  1076. )INFO
  1077. Adata
  1078. 6VV0V66
  1079. iTV=g
  1080. VT3Ti
  1081. =!=!3!3!!!!!=!3==
  1082. *INFO
  1083. ACLPSdata
  1084. H!33H
  1085. +INFO
  1086. AMFLdata
  1087. 3+BiO
  1088. ,INFO
  1089. AMLdata
  1090. -+BiO
  1091. -INFO
  1092. AMMIXdata
  1093. !G6APP
  1094. .+BiO
  1095. .INFO
  1096. AMRdata
  1097. H/H!!H!H!H!
  1098. H!/H!/(H
  1099. /INFO
  1100. AMSdata
  1101. 0INFO
  1102. AMSHWdata
  1103. $TT1    
  1104. /-H!H
  1105. 3+BiO
  1106. 1INFO
  1107. AMTRWdata
  1108. iTTT1?T
  1109. VT]=\T=VTT
  1110. 2INFO
  1111. Cdata
  1112. HH!H!H
  1113. 3INFO
  1114. Fdata
  1115. 3!333333!33333!33333!
  1116. "TAIL
  1117. 4INFO
  1118. Hdata
  1119. AA'!!P
  1120. 5INFO
  1121. Odata
  1122. !33!H
  1123. 6INFO
  1124. IPdata
  1125. !!AA'A
  1126. 7INFO
  1127. IPZRdata
  1128. 8INFO
  1129. ISTRWdata
  1130. 5']]]
  1131. 9INFO
  1132. Ldata
  1133. :INFO
  1134. Ndata
  1135. ;INFO
  1136. RIPdata
  1137. ]']=]
  1138. RZR+BiO
  1139. <INFO
  1140. RZRdata
  1141. rVV!A!VP
  1142. SCT+BiO
  1143. =INFO
  1144. SCTRWdata
  1145. 5TTTi3T
  1146. >INFO
  1147. SIPdata
  1148. 3=!3]!
  1149. ?INFO
  1150. STRdata
  1151. \4VT3    
  1152. AINFO
  1153. SUNdata
  1154. @INFO
  1155. SZRdata
  1156. $\/1T
  1157. 33=]3!-
  1158. QINFO
  1159. Bdata
  1160. 6VV0V66
  1161. iTV=g
  1162. VT3Ti
  1163. =!=!3!3!!!!!=!3==
  1164. RINFO
  1165. LCTdata
  1166. 6VV0V66
  1167. iTV=g
  1168. VT3Ti
  1169. =!=!3!3!!!!!=!3==
  1170. SINFO
  1171. PCdata
  1172. 6VV0V66
  1173. iTV=g
  1174. VT3Ti
  1175. =!=!3!3!!!!!=!3==
  1176. TINFO
  1177. Edata
  1178. H!33H
  1179. UINFO
  1180. MCdata
  1181. H!33H
  1182. VINFO
  1183. MCLDYdata
  1184. H!33H
  1185. WINFO
  1186. VCLDYdata
  1187. H!33H
  1188. XINFO
  1189. AMMSQdata
  1190. YINFO
  1191. AMMSWdata
  1192. ZINFO
  1193. FLdata
  1194. [INFO
  1195. Jdata
  1196. \INFO
  1197. LCJdata
  1198. ]INFO
  1199. LGTSdata
  1200. ^INFO
  1201. Mdata
  1202. _INFO
  1203. PMFLdata
  1204. `INFO
  1205. PMSSQdata
  1206. aINFO
  1207. PMSSWdata
  1208. bINFO
  1209. SSHWdata
  1210. fINFO
  1211. LCOdata
  1212. !G6APP
  1213. gINFO
  1214. MIXdata
  1215. !G6APP
  1216. hINFO
  1217. !G6APP
  1218. iINFO
  1219. HVYRdata
  1220. H/H!!H!H!H!
  1221. H!/H!/(H
  1222. jINFO
  1223. PMRdata
  1224. H/H!!H!H!H!
  1225. H!/H!/(H
  1226. kINFO
  1227. Rdata
  1228. H/H!!H!H!H!
  1229. H!/H!/(H
  1230. lINFO
  1231. HVYSdata
  1232. mINFO
  1233. Pdata
  1234. nINFO
  1235. PMSdata
  1236. oINFO
  1237. Qdata
  1238. pINFO
  1239. Sdata
  1240. qINFO
  1241. SSQ.COPYdata
  1242. rINFO
  1243. SNOWdata
  1244. sINFO
  1245. PMSHWdata
  1246. $TT1    
  1247. /-H!H
  1248. tINFO
  1249. SHWdata
  1250. $TT1    
  1251. /-H!H
  1252. uINFO
  1253. Wdata
  1254. $TT1    
  1255. /-H!H
  1256. vINFO
  1257. PMTRWdata
  1258. iTTT1?T
  1259. VT]=\T=VTT
  1260. wINFO
  1261. CLDYdata
  1262. HH!H!H
  1263. xINFO
  1264. FOGdata
  1265. 3!333333!33333!33333!
  1266. "TAIL
  1267. yINFO
  1268. RSdata
  1269. !33!H
  1270. zINFO
  1271. RTSdata
  1272. !33!H
  1273. {INFO
  1274. Xdata
  1275. !!AA'A
  1276. V+BiO
  1277. |INFO
  1278. OLD.ICTdata
  1279. 5']]]
  1280. }INFO
  1281. WNDYdata
  1282. ~INFO
  1283. YCOPYdata
  1284. rVV!A!VP
  1285. ZRdata
  1286. rVV!A!VP
  1287. SRTRWdata
  1288. 5TTTi3T
  1289. Tdata
  1290. 5TTTi3T
  1291. TRWdata
  1292. 5TTTi3T
  1293. ?+BiO
  1294. Udata
  1295. Vdata
  1296. SSTRWdata
  1297. 6VV0V66
  1298. iTV=g
  1299. VT3Ti
  1300. =!=!3!3!!!!!=!3==
  1301. !G6APP
  1302. MTRdata
  1303. !G6APP
  1304. PMRSdata
  1305. !33!H
  1306. AMRSdata
  1307. !33!H
  1308. 1+BiO
  1309. SCSSWdata
  1310. D///////
  1311. RGwqGeGG
  1312. 1+BiO
  1313. SPMSWdata
  1314. D///////
  1315. RGwqGeGG
  1316. ZLdata
  1317. Z|    +CW
  1318. H!!!H
  1319. ]    ii?=g    
  1320. 3]3=3=3
  1321. 3=33=
  1322. FSHWdata
  1323. LCWdata
  1324. LGTRdata
  1325. MTSVRdata
  1326. PMLdata
  1327. SCSWdata
  1328. compass_hilitedata
  1329. pppppp
  1330. vppppppv
  1331. pppvp
  1332. pppppv
  1333. pppppv
  1334. ppppppppppppv
  1335. eX._R
  1336. pppppp
  1337. pppppppp
  1338.     AAHKAN"
  1339.     _    UW
  1340. 2AGU8NM\
  1341. tHGWRdlH
  1342. t0QM0l
  1343. pppppp
  1344. pppppp
  1345. ppppppv
  1346. ppppppp
  1347. ppppv
  1348. pppppppppp
  1349. ppppppv
  1350. pppppp
  1351. ppppv
  1352. Help_hilitedata
  1353. kdcee
  1354. $$%{$^$z
  1355. eedee
  1356. eeedeee
  1357. ddeedeed
  1358. edeedeed
  1359. edeededd
  1360. eedekee
  1361. [~[[%%
  1362. $$$$$$
  1363. cedeedeek
  1364. $$$$$
  1365. $$$$$
  1366. deeeee
  1367. $$$$$
  1368. WIWIWIPIPIPCPN^N^P^^T/
  1369. ebedce
  1370. $$$$$$$
  1371. dedekdeddd
  1372. $$$$$$
  1373. $$$$$$$$$
  1374. ~"~"~"~:~
  1375. }}}g}
  1376.  ~ Dad#
  1377. ggggg
  1378. ededcedeedd
  1379. $$$$$
  1380. $$$$$$$$
  1381. Bgggg
  1382. !;E;!ZF
  1383. edddddjdd
  1384. $$$$$
  1385. >+----,
  1386. VW--,-
  1387. keebd
  1388. keece
  1389. dddceed
  1390. eeeee
  1391. $$$$$$$$$$$
  1392. edjdeek
  1393.  : ~ 
  1394.  : d  D
  1395. $$$$$
  1396. ceecekee
  1397. deecd
  1398.   D#e
  1399. $$$$$
  1400. ekeekeeek
  1401. :: : ^ 
  1402. 4eqqkW=
  1403. djdeek
  1404. "E"Gd
  1405. dceedb
  1406. ddeee
  1407. $$$$$
  1408. Z]4D_
  1409. eecee
  1410. $$$$$
  1411. $$$$$
  1412. $$$$$$$$$
  1413. $$$$$
  1414. jdbddd
  1415. $$$$$$
  1416. $$$$$
  1417. $$$$$
  1418. $$$$$
  1419. $$$$$
  1420. $$$$$$$$$
  1421. $$$$$$$$
  1422. eeeke
  1423. $$$$$$$$$$$
  1424. beedbd
  1425. $$$$$$$$$$$$
  1426. $$$$$
  1427. +%,]d
  1428. $$$$$$
  1429. g:D  
  1430. $$$$$
  1431. g:D  E
  1432. $$$$$
  1433. keecdj
  1434. $$$$$$$$$$
  1435. $$$$$$$$$$$
  1436. djdceej
  1437. $$$$$$$$
  1438. ekecee
  1439. $$$$$$$$
  1440. $$$$$$$$
  1441. $$$$$$$$$$$$$$$
  1442. kecek
  1443. $$$$$$$$$$$$$$$$$
  1444. $$$$$$$$$$$$$$$$$
  1445. eceke
  1446. $$$$$$$$$$$$$$$$$
  1447. $$$$$$
  1448. dDggf
  1449. $$$$$$
  1450. kecebdbek
  1451. $$$$$$$$$$
  1452. ecdke
  1453. $$$$$$$$$
  1454. kekddcdke
  1455. $$$$$$$$$$$$$$$$$
  1456. $$$$$$$$$$$$$$$$$
  1457. $$$$$$$$$$$$$$$$$
  1458. dede dd~D
  1459. ddddeed~dD
  1460. [Ueek
  1461. $$$[[
  1462. [Uekj
  1463. $$$$$$
  1464. ccdke
  1465. $$$$$$
  1466. $$$$$#
  1467. $$$$$
  1468. $$$$$$
  1469. B\B\\\\
  1470. \xx~\
  1471. $$#$$
  1472. $:$$$$
  1473. $$$}\
  1474. $$$$$$$$
  1475. bcejke
  1476. #$$$$$
  1477. $#$$$$
  1478. $$$$$$$
  1479. $#$$$$$
  1480. cdjke
  1481. $$$$$#
  1482. dkkdcb
  1483. $$#$$$
  1484. $$$$$$
  1485. $##$$
  1486. 1T[1dc
  1487. StartOver_hilitedata
  1488. ppppppppppp
  1489. ppppppppppp
  1490. pppppppppp
  1491. pppppppppp
  1492. ppppppp
  1493. ppppppp
  1494. pppppppppp
  1495. pppppppppp
  1496. Trivia_hilitedata
  1497. pppppppppp
  1498. ppppppppppp
  1499. ppppppp
  1500. ppppppp
  1501. ppppppp
  1502. ppppppp
  1503. ppppp+BiO
  1504. Day1_hilitedata
  1505. ppppppppppp
  1506. pppppppppp
  1507. pppppppppp
  1508. pppppppppp
  1509. vpppppp
  1510. ppppppv
  1511. Continue_hilitedata
  1512. pppppp
  1513. pppppp
  1514. ppppu
  1515. upppp
  1516. pppppvu
  1517. vppppp
  1518. Help_BackToMap_hilitedata
  1519. mggfgfgfgfgfgffgffff#ff
  1520. f"f"f"""f!"e"!e"!
  1521. D^ ^~
  1522. FG}|}|}|}
  1523. }|}8G
  1524. G}}8}{
  1525. {F9}]
  1526. F]F:]~]:F^:~^
  1527. d;d;dd
  1528. d;d;;dE
  1529. DG;~d
  1530. Dd:~d:~:^d
  1531. ^d~^~:Dd
  1532. ^~:d:Dd ^~^:dD:~d ^~:Dd ^~
  1533. ^ ^^ 
  1534. ^~]}v
  1535. ~G}GG
  1536. GG^DG
  1537. LG}^^
  1538. ppppp
  1539. ppppp
  1540. ^(VxdY(
  1541. VVEDU
  1542. cO{[WGEdbbR
  1543. beOgD
  1544. VbdUG
  1545. 1Lddb]
  1546. ebbfRa}fzzG|dzz}G
  1547. bdzEEd
  1548. zdbez
  1549. dEeEE
  1550. BdDEe
  1551. ecdA]
  1552. Edbbd
  1553. !zEzEDEbDEEGFbGDADFD"GF}@GFG}EG
  1554. #FGGFGFFDFFD}A}:d
  1555. Edbbdbbb
  1556. zDzDD
  1557. :d$&s<
  1558. [[>P>\
  1559. Z>QZ>Q>Z-Z']
  1560. W**VR
  1561. <000000000/00/00/00/00/00/00/00/00/00/00/00/00/00/00/00/00/00/00/00/00/00/00/00/00/0;
  1562. *TAIL
  1563. jCARD
  1564. National_hilitedata
  1565. Help_hilitedata
  1566. WIWIWIPIPIPCPN^N^P^^T/
  1567. ~"~"~"~:~
  1568. }}}g}
  1569.  ~ Dad#
  1570. ggggg
  1571. Bgggg
  1572. !;E;!ZF
  1573.  : ~ 
  1574.  : d  D
  1575. D DG 
  1576. :: : ^ 
  1577. 4eqqkW=
  1578. "E"Gd
  1579. Z]4D_
  1580. +%,]d
  1581. g:D  
  1582. g:D  E
  1583. dDggf
  1584. Dd[~d~~
  1585. Zd>@>
  1586. v0T:{{
  1587. ~d%d$d$Z
  1588. B\B\\\\
  1589. \xx~\
  1590. $:$$$$
  1591. $$$}\
  1592. qTAIL
  1593. StartOver_hilitedata
  1594. ppppppppppp
  1595. ppppppppppp
  1596. pppppppppp
  1597. pppppppppp
  1598. ppppppp
  1599. ppppppp
  1600. pppppppppp
  1601. pppppppppp
  1602. GoBack_hilitedata
  1603. ppppppppppp
  1604. ppppppppppp
  1605. pppppppp"
  1606. pppppppp
  1607. ppppppp
  1608. ppppppp
  1609. NextDay_hilitedata
  1610. ppppppppppp
  1611. ppppppppppp
  1612. pppppppp
  1613. pppppppp
  1614. ppppppp
  1615. ppppppp
  1616. ppppppp
  1617. ppppppp
  1618. tCARD
  1619. Region_hilitedata
  1620. Help_BackToMap_hilitedata
  1621. mggfgfgfgfgfgffgffff#ff
  1622. f"f"f"""f!"e"!e"!
  1623. D^ ^~
  1624. FG|}:;
  1625. ;d;d;
  1626. ;__;;_d_
  1627. d;d;dd
  1628. d;d;;dE
  1629. DG;~d
  1630. Dd:~d:~:^d
  1631. ^d~^~:Dd
  1632. ^~:d:Dd ^~^:dD:~d ^~:Dd ^~
  1633. ^ ^^ 
  1634. ^~]}v
  1635. ~G}GG
  1636. GG^DG
  1637. LG}^^
  1638. ^(VxdY(
  1639. VVEDU
  1640. cO{[WGEdbbR
  1641. beOgD
  1642. VbdUG
  1643. 1Lddb]
  1644. ebbfRa}fzzG|dzz}G
  1645. ppppp
  1646. ppppp
  1647. Edbbd
  1648. !zEzEDEbDEEGFbGDADFD"GF}@GFG}EG
  1649. #FGGFGFFDFFD}A}:d
  1650. Edbbdbbb
  1651. zDzDD
  1652. :d$&s<
  1653. [[>P>\
  1654. Z>QZ>Q>Z-Z']
  1655. W**VR
  1656. *TAIL
  1657. Zdata
  1658. 1GRPO
  1659. 8data
  1660. 5TAIL
  1661. )data
  1662. ggxgggxg
  1663. /P~~u~
  1664. ~xkkk
  1665. ZuE+a$a
  1666. xX&Xm822
  1667. dy%\;
  1668. ;%%\\\
  1669. ^XXYXYXYXY
  1670. %\\&#
  1671. PBsl6
  1672. Y^^^^^^
  1673. XY_Y_
  1674. I-d===
  1675. =<0)jS
  1676. <:)QS
  1677. g__FTl
  1678. <<<]qkS
  1679. =668`qm_
  1680. ^^YXXY^
  1681. uuu~u
  1682. F933u
  1683. 6680`
  1684. 3w}wf
  1685. 660XqSU
  1686. '''-'!(!
  1687. 3U}wwff
  1688. >:>:>:0:
  1689. 668666
  1690. 66>6>
  1691. XX#Im3U
  1692. uwuwjfj
  1693. Imkm.
  1694. m3OIC
  1695. guu{{
  1696. u{{{u
  1697. 55555
  1698. !!(!    
  1699. 1TAIL
  1700. +data
  1701. xgggxggg
  1702. /P~~u~
  1703. ~xkkk
  1704. ZuE+a$a
  1705. xX&Xm822
  1706. dy%\;
  1707. ;%%\\\
  1708. XY_YXY^
  1709. XYXXY_YX^
  1710. %lslC
  1711. %%%\\&#
  1712. %QBsI7
  1713. "QBsN
  1714. XY_Y_
  1715. %\\%#
  1716. =<:)p
  1717. gg_g8
  1718. ^^^YXXYX
  1719. 888888
  1720. 888888/-
  1721. Y^Y^^^^^
  1722. <<<4`qkS
  1723. uuu~u
  1724. FFF9uuu
  1725. 3wgff
  1726. 660XkSU
  1727. 6>808>6>>X0>f
  1728. uwuwjfj
  1729. Imkm.
  1730. m3OIC
  1731. guu{{
  1732. u{{{u
  1733. 55555
  1734. 4TAIL
  1735. -data
  1736. xgggxggg
  1737. /P~~u~
  1738. ~xkkk
  1739. ZuE+a$a
  1740. xX&Xm822
  1741. dy%\;
  1742. XY_YXY^
  1743. gggggggx
  1744. YYYY^
  1745. =lsl[
  1746. %%%\\&#
  1747. Y^^^^^Y_Y^^
  1748. ^QBs2
  1749. XY_Y_
  1750. %\\%#
  1751. -d=dX
  1752. gg_g8
  1753. <0)_S
  1754. ^Y^^^XY_
  1755. 88888
  1756. 888888
  1757. 888888/-
  1758. 86604`
  1759. uuu~u
  1760. FFF9uuu
  1761. 6680`
  1762. 3wwwl
  1763. 660XqSU
  1764. 6>808>6>>X0>f
  1765. `#868
  1766. uwuwjfj
  1767. Imkm.
  1768. aUOOO
  1769. guu{{
  1770. u{{{u
  1771. 55555
  1772. 0TAIL
  1773. /data
  1774. C%C&y:
  1775. ZEu8a
  1776. xX&Xm822
  1777. dy%\\
  1778. ;%%\\\
  1779. XY_YXY^
  1780. gggggggx
  1781. YYYY^
  1782. %%%\\&#
  1783. QBsl7
  1784. %QBsI
  1785. XY_Y_
  1786. %\\%#
  1787. =YXYX=
  1788. gg_g8
  1789. YYXYYYXY
  1790. ?<0)hS
  1791. 88888
  1792. 888888
  1793. 888888/-
  1794. Y^^^Y_
  1795. 6604`
  1796. uuu~u
  1797. FFF9uuu
  1798. 66>VkSU
  1799. 6>808>6>>X0X
  1800. uwuwjfj
  1801. >--um~~38
  1802. Imkm.
  1803. m3OIC
  1804. guu{{
  1805. u{{{u
  1806. 55555
  1807. 4TAIL
  1808. 1data
  1809. xgggxggg
  1810. /P~~u~
  1811. ~xkkk
  1812. ZuE+a$a
  1813. xX&Xm822
  1814. dy%\\
  1815. XY_YXY^
  1816. gggggggx
  1817. YYYY^
  1818. %%%\\&#
  1819. QBsl7
  1820. %QBsI
  1821. XY_Y_
  1822. %\\%#
  1823. XeeeY
  1824. gg_g8
  1825. YXYXY
  1826. ?<0)hS
  1827. Y^^^^^YXYX
  1828. <:a-kU
  1829. 888888
  1830. Y^^^Y_
  1831. 888888/-
  1832. uuu~u
  1833. FFF9uuu
  1834. 3wgff
  1835. 660XkSU
  1836. 6>808>6>>X0>f
  1837. uwuwjfj
  1838. Imkm.
  1839. m3OIC
  1840. guu{{
  1841. u{{{u
  1842. 55555
  1843. 2TAIL
  1844. 3data
  1845. C%C&y:
  1846. dy%\\_gggd
  1847. ;%%\\\
  1848. XY_YXY^
  1849. YXXY_YX^
  1850. %\\&#
  1851. Y^^^^^Y_Y^^
  1852. Y^^^^^^
  1853. XY_Y_
  1854. YYYYYYY
  1855. YYYYYYYY
  1856. YYXYXY
  1857. YIIIIIII
  1858. IIIIIIII
  1859. IHIHIHI
  1860. IIII-==
  1861. d====
  1862. =d=d====
  1863. IIIdddI--dIII
  1864. ddYY==
  1865. <0)Wk_
  1866. d=d==
  1867. tI-IIY
  1868. YIIIIII-I==IIIIII-Id==
  1869. YYdddd
  1870. YYYddd
  1871. YX^Xd
  1872. =======
  1873. ========
  1874. ^===Y
  1875. XY==d
  1876. <0)SS
  1877. TF3''
  1878. Y^^^^XYXXY
  1879. Y^^^X
  1880. XY^^Y_
  1881. g__FTl
  1882. <<<XqkS
  1883. ___3rxl
  1884. uuu~u
  1885. F933u
  1886. 6680`
  1887. dsF33
  1888. 66666666666666
  1889. 66>VqSS
  1890. 6666666
  1891. 0V0>``
  1892. `#868
  1893. uwuwjfj
  1894. 6864X`XkkkqqqSqqqqg
  1895. mju{~888~m
  1896. Imkm.
  1897. ....8?8
  1898. 88888
  1899. 8.8.8888.
  1900. guu{{
  1901. u{{{u
  1902. 5b__W
  1903. !!(!    
  1904. 2TAIL
  1905. INL 58TAIL
  1906. f===8
  1907. WZWZW
  1908. p===f
  1909. ,7,,7,,
  1910. zb"$?$$?$$z
  1911. ~k]]?~
  1912. ,,,,,,,{
  1913. {,v,v{+{v{vv{
  1914. ===;    
  1915. ==4;4==
  1916. bbs B
  1917. bbs B
  1918. bbs B
  1919. FridayTAIL
  1920. gWC1dayafterTAIL
  1921. gWC2daysafterTAIL
  1922. 55 / 35TAIL
  1923. 45 / 35TAIL
  1924. 36 / 26TAIL
  1925. $TT1    
  1926. /-H!H
  1927. 6VV0V66
  1928. iTV=g
  1929. VT3Ti
  1930. =!=!3!3!!!!!=!3==
  1931. As of Thursday, November 10, 1994 TAIL
  1932. !data
  1933. E+TXT
  1934. =data
  1935. Edata
  1936. ll~l~~LC
  1937. 2/s{*
  1938. ==FH*
  1939. III-III-I-I-I
  1940. ddkdddddddd
  1941. Ydd~Y
  1942. ======d
  1943. d~Y~d
  1944. =5?>?
  1945. Z?>fY
  1946. fZfd|Z|||
  1947. ===d=d=
  1948. =d=~Y'
  1949. =Yd=~YYi
  1950. `%<+@D\??
  1951. |    ;;yr
  1952. !cbc^+3
  1953. <vDb3O?qD@%
  1954. 77777
  1955. 8HFii
  1956. DaaP-]
  1957. qTAIL
  1958. 5data
  1959. C%C&y:
  1960. ZEu8a
  1961. xX&Xm822
  1962. dy%\\_gggd
  1963. XY_YXY^
  1964. YXXY_YX^
  1965. %%%\\&#
  1966. Y^^^^^Y_Y^^
  1967. Y^^^^^^
  1968. XY_Y_
  1969. %\\%#
  1970. YYYYYYYY
  1971. YYYYYYY
  1972. IIIIIIIY
  1973. IIIIIII
  1974. YHIHI
  1975. XIHIHHI
  1976. IIIId=
  1977. IIIeY
  1978. IIII==
  1979. -IIIY=
  1980. <0)Wk_
  1981. IIIIIII
  1982. IIIIIII
  1983. HII=Y
  1984. Ydddddd=
  1985. =Yddddddd
  1986. gg_g8
  1987. =<0)jS
  1988. nF='3
  1989. YYXY^^^^
  1990. 88888
  1991. 888888
  1992. Y^^Y_
  1993. 888888/-
  1994. <<<ZqkS
  1995. uuu~u
  1996. FFF9uuu
  1997. 6680`
  1998. dsF33
  1999. 3wwwl
  2000. 660XqSU
  2001. 6666666
  2002. 0V0>``
  2003. uwuwjfj
  2004. 6864X`XkkkqqqSqqqqg
  2005. mju{~888~m
  2006. Imkm.
  2007. ....8?8
  2008. 88888
  2009. 8.8.8888.
  2010. guu{{
  2011. u{{{u
  2012. 5b__W
  2013. 2TAIL
  2014. &data
  2015. :data
  2016. ;data
  2017. Hdata
  2018. d0dxk
  2019. !T!T[!Tdx
  2020. RTk^bk9_^
  2021. Tdddd60
  2022. 59dkP_
  2023. !T0Tw
  2024. 60606kdd9dd
  2025. w!60609
  2026. ZH,U0
  2027. ^0[x!
  2028. |6dk^t
  2029.  UcZbz9
  2030. C[~ Z1Gb
  2031. d9d6k69[C
  2032. R9999
  2033. z9k999C6
  2034. ^_Pu9R6999
  2035. Idata
  2036. Jdata
  2037. c$]c!
  2038. `Iw65
  2039. `wc55
  2040. Ewq5!
  2041. Kdata
  2042. Ldata
  2043. !!wE5
  2044. !!wI`^
  2045. 55cIw
  2046. !55Nk
  2047. Pdata
  2048. ,6\\ff
  2049. 111717
  2050. 1111177
  2051. }hf\fffffff\\P\\f
  2052. 117177
  2053. QHHQH
  2054. (TAIL
  2055. 3INFO
  2056. ,INFO
  2057. RegionsSCRP
  2058. on initializeCard
  2059.   global gWCwhichday
  2060.   global gWCcurrReg
  2061.   global gNAVcdev
  2062.   global gWCtoday
  2063.   global gWCacceptMouseClicks
  2064.   --  global gWCalarmIsSet
  2065.   global gWCplayedRegVoice
  2066. --  global gNAVEpcotPath
  2067.   global gWCvoicePath
  2068.   global gWCpath
  2069.   global gWCregVoice
  2070.   global gWCregMusic, gPathAudio,gWCtomorrow, gWCdate
  2071.   put "false" into gWCacceptMouseClicks
  2072.   put "false" into gWCalarmIsSet
  2073.   disableNavBtn
  2074.   lock screen
  2075.   put "today" into gWCwhichday
  2076.   hide bg grp "Day_bmps"
  2077.   show bg bmp gWCtomorrow
  2078.   put gWCdate into bg fld "DayOfWeek"
  2079.   show bg fld "DayOfWeek"
  2080.   put the number of this card into gWCcurrReg
  2081.   --clearIdleAlarm
  2082.   unlock screen
  2083.   put gWCtomorrow into bg fld "Tomorrow"
  2084.   put gWC1dayafter into bg fld "1DayAfter"
  2085.   put gWC2daysafter into bg fld "2DaysAfter"
  2086. end initializeCard
  2087. -------------------------
  2088. on showInitialLoc
  2089.   global gWChilitedBtn
  2090.   global gWCcallingBtn
  2091.   global gWCcd_or_bg
  2092.   put "background" into gWCcd_or_bg
  2093.   put "NextDay" into gWChilitedBtn
  2094.   send mouseDown to bg btn gWChilitedBtn
  2095.   put empty into gWCcallingBtn
  2096. end showInitialLoc
  2097. -------------------------
  2098. on closeCard
  2099.   global gWChilitedBtn
  2100.   global gWCcd_or_bg
  2101.   mouseHasBeenClicked
  2102.   if gNAVcdev is "REMOTE" then
  2103.     if gWCcd_or_bg is "card" then
  2104.       send mouseLeave to cd btn gWChilitedBtn
  2105.     else
  2106.       send mouseLeave to bg btn gWChilitedBtn
  2107.     end if
  2108.   end if
  2109.   show cd grp "Cities"
  2110.   hide bg fld "DayOfWeek"
  2111. end closeCard
  2112. -------------------------
  2113. --on idle
  2114.   --setIdleAlarm
  2115. --end idle
  2116. -------------------------
  2117. on setIdleAlarm
  2118.   global gWCalarmIsSet
  2119.   if gWCalarmIsSet is "false" then
  2120.     put "true" into gWCalarmIsSet
  2121.     --ring bg alarm "idle_alarm" at 3600
  2122.     --start bg timer "idle_alarm" expire in 3600 ticks
  2123.   end if
  2124. end setIdleAlarm  
  2125. -------------------------
  2126. on clearIdleAlarm
  2127.   put "false" into gWCalarmIsSet
  2128.   --clear bg alarm "idle_alarm"
  2129.   --stop bg timer "idle_alarm"
  2130. end clearIdleAlarm
  2131. -------------------------
  2132. on enableNavBtn
  2133.   enable bg btn "GoBack"
  2134.   enable bg btn "StartOver"
  2135.   enable bg btn "Region"
  2136.   enable bg btn "NextDay"
  2137.   enable bg btn "Help"
  2138.   enable bg btn "Region"
  2139.   enable bg btn "GoToUpReg"
  2140.   enable bg btn "GoToDownReg"
  2141.   enable bg btn "GoToLeftReg"
  2142.   enable bg btn "GoToRightReg"
  2143.   repeat with i= 1 to number of buttons in card
  2144.     enable btn i
  2145.   end repeat
  2146. end enableNavBtn
  2147. -------------------------
  2148. on disableNavBtn
  2149.   disable bg btn "GoBack"
  2150.   disable bg btn "StartOver"
  2151.   disable bg btn "Region"
  2152.   disable bg btn "NextDay"
  2153.   disable bg btn "Help"
  2154.   disable bg btn "Region"
  2155.   disable bg btn "GoToUpReg"
  2156.   disable bg btn "GoToDownReg"
  2157.   disable bg btn "GoToLeftReg"
  2158.   disable bg btn "GoToRightReg"
  2159. end disableNavBtn
  2160. -------------------------
  2161. on cityButtonPush thiscity
  2162.   global gWChilitedBtn
  2163.   global gNAVcdev
  2164.   global gWCcallingBtn
  2165.   global gWCcd_or_bg
  2166.   global gWCacceptMouseClicks
  2167.   global gNAVEpcotPath
  2168.   global gWCpath
  2169.   global gWCtriviaVoice
  2170.   global gWCvoicePath, gPathAudio
  2171.   if gWCacceptMouseClicks is not "false" then
  2172.     mouseHasBeenClicked
  2173.     send mouseLeave to cd btn thiscity of this card
  2174.     send mouseDown to cd btn thiscity of this card
  2175.     send mouseLeave to cd btn thiscity of this card
  2176.     send mouseDown to cd btn thiscity of this card
  2177.     send mouseLeave to cd btn thiscity of this card
  2178.     lock screen
  2179.     hide cd group "Cities"
  2180.     show cd grp thiscity
  2181.     unlock screen
  2182.     getForecast (the citycode of cd btn thiscity), (the number of this card)
  2183.     show bg grp "Forecast"
  2184.     if gNAVcdev is "REMOTE" then
  2185.       send mouseLeave to cd btn gWChilitedBtn
  2186.       put gWChilitedBtn into gWCcallingBtn
  2187.       put "Continue" into gWChilitedBtn
  2188.       put "background" into gWCcd_or_bg
  2189.       send mouseDown to bg btn gWChilitedBtn
  2190.       
  2191.       select char 1 of bg fld "Keypress"
  2192.     else
  2193.       put thiscity into gWCcallingBtn
  2194.       disable cd btn thiscity of this card
  2195.     end if
  2196.     --    ring bg alarm "alarmGoBack" at 1800
  2197.     start bg timer "alarmGoBack" expire in 1800 ticks
  2198.     --    play file (gNAVEpcotPath & gWCpath & gWCvoicePath & gWCtriviaVoice) nowait
  2199.     set the soundFile of bg snd "main" to 
  2200.         (gPathAudio & gWCtriviaVoice)
  2201.     set the bufferSize of bg snd "main" to 180
  2202.     set the playVolume of bg snd "main" to 100
  2203.     play bg snd "main"
  2204.   end if
  2205. end cityButtonPush
  2206. -------------------------
  2207. on cityButtonDown thiscity
  2208.   global gWCacceptMouseClicks
  2209. --  clearIdleAlarm
  2210.   if gWCacceptMouseClicks is not "false" then
  2211.     do "show cd bmp" && quote & thiscity & "_hilite" & quote && "of this card"
  2212.   end if
  2213. end cityButtonDown
  2214. -------------------------
  2215. on cityButtonLeave thiscity
  2216.   --clearIdleAlarm
  2217.   do "hide cd bmp" && quote & thiscity & "_hilite" & quote && "of this card"
  2218. end cityButtonLeave
  2219. -------------------------
  2220. on bgButtonDown thisbtn
  2221.   global gWCacceptMouseClicks
  2222. --  clearIdleAlarm
  2223.   --if gWCacceptMouseClicks is not "false" then
  2224.   do "show bg bmp" && quote & thisbtn & "_hilite" & quote
  2225.   --end if
  2226. end bgButtonDown
  2227. -------------------------
  2228. on bgButtonLeave thisbtn
  2229.   --clearIdleAlarm
  2230.   do "hide bg bmp" && quote & thisbtn & "_hilite" & quote
  2231. end bgButtonLeave
  2232. -------------------------
  2233. on GoToReg thisBtn,regDir
  2234.   global gWCregNav
  2235.   global gWCupReg
  2236.   global gWCrightReg
  2237.   global gWCdownReg
  2238.   global gWCleftReg
  2239.   global gWCacceptMouseClicks
  2240.   global gWChilitedBtn
  2241.   global gWCcd_or_bg
  2242.   global gNAVcdev
  2243.   if gWCacceptMouseClicks is not "false" then
  2244.     mouseHasBeenClicked
  2245.     lock screen
  2246.     send mouseDown to bg btn thisBtn
  2247.     send mouseFlash to bg btn "Region"
  2248.     unlock screen
  2249.     lock screen
  2250.     send mouseLeave to bg btn thisBtn
  2251.     send mouseLeave to bg btn "Region"
  2252.     unlock screen
  2253.     put word 1 of line regDir of gWCregNav into whichReg
  2254.     if whichReg is "none" then
  2255.       beep
  2256.       if gNAVcdev is "REMOTE" then
  2257.         if gWCcd_or_bg is "card" then
  2258.           send mouseDown to cd btn gWChilitedBtn
  2259.         else
  2260.           send mouseDown to bg btn gWChilitedBtn
  2261.         end if
  2262.       end if
  2263.     else
  2264.       lock screen
  2265.       send mouseDown to bg btn thisBtn
  2266.       send mouseFlash to bg btn "Region"
  2267.       unlock screen
  2268.       lock screen
  2269.       send mouseLeave to bg btn thisBtn
  2270.       send mouseLeave to bg btn "Region"
  2271.       unlock screen
  2272.       hide cd grp "Cities" of cd whichReg
  2273.     end if
  2274.     if regDir is gWCupReg then
  2275.       visual effect scroll down
  2276.     else if regDir is gWCrightReg then
  2277.       visual effect scroll left
  2278.     else if regDir is gWCdownReg then
  2279.       visual effect scroll up
  2280.     else if regDir is gWCleftReg then
  2281.       visual effect scroll right
  2282.     end if
  2283.     go to card whichReg
  2284.   end if
  2285. end GoToReg
  2286. -------------------------
  2287. on getForecast city, region
  2288.   --  global gWCdata
  2289.   global gWCnumcitytotal
  2290.   global gWCerror
  2291.   put empty into bg fld "Key"
  2292.   put city into bg fld "Key"
  2293.   put " " after bg fld "Key"
  2294.   -- Search data fld for weather info of next 3 days
  2295.   repeat with y=2 to (gWCnumcitytotal + 1)
  2296.     if city is word 1 of line y of bg fld "wCdata" then exit repeat
  2297.     if y = (gWCnumcitytotal + 1) then put "getForecast" into gWCerror
  2298.   end repeat
  2299.   put y after bg fld "Key"
  2300.   -- Put data and bitmaps into 3-day forecast pop-up
  2301.   -- tomorrow
  2302.   do "put word 6 of line" && y && "of bg fld WCdata into bg fld temp_Tomorrow"
  2303.   do "put" && quote & " / " & quote && "after bg fld temp_Tomorrow"
  2304.   do "put word 5 of line" && y && "of bg fld WCdata after bg fld temp_Tomorrow"
  2305.   do "put cd bmp" && quote & word 7 of line y of bg fld WCdata & quote && "of card Icons into bg bmp icon_Tomorrow"
  2306.   --select line 1 of bg fld temp_Tomorrow
  2307.   --set the textcolor of bg fld temp_Tomorrow to 79
  2308.   --set the textcolor of bg fld Tomorrow to 12
  2309.   --set the textfont of bg fld temp_Tomorrow to Helvetica
  2310.   --set the textstyle of bg fld temp_Tomorrow to bold
  2311.   --set the textalign of bg fld temp_Tomorrow to center
  2312.   --set the textsize of bg fld temp_Tomorrow to 16
  2313.   --select empty
  2314.   -- 1dayafter
  2315.   global gWC1dayafter
  2316.   put gWC1dayafter into bg fld "1dayafter"
  2317.   do "put word 9 of line" && y && "of bg fld WCdata into bg fld temp_1DayAfter"
  2318.   do "put" && quote & " / " & quote && "after bg fld temp_1DayAfter"
  2319.   do "put word 8 of line" && y && "of bg fld WCdata after bg fld temp_1DayAfter"
  2320.   do "put cd bmp" && quote & word 10 of line y of bg fld WCdata & quote && "of card Icons into bg bmp icon_1DayAfter"
  2321.   --select line 1 of bg fld temp_1DayAfter
  2322.   --set the textcolor of bg fld temp_1DayAfter to 79
  2323.   --set the textcolor of bg fld Tomorrow to 12
  2324.   --set the textfont of bg fld temp_1DayAfter to Helvetica
  2325.   --set the textstyle of bg fld temp_1DayAfter to bold
  2326.   --set the textalign of bg fld temp_1DayAfter to center
  2327.   --set the textsize of bg fld temp_1DayAfter to 16
  2328.   --select empty
  2329.   -- 2daysafter
  2330.   global gWC2daysafter
  2331.   put gWC2daysafter into bg fld "2daysafter"
  2332.   do "put word 12 of line" && y && "of bg fld WCdata into bg fld temp_2DaysAfter"
  2333.   do "put" && quote & " / " & quote && "after bg fld temp_2DaysAfter"
  2334.   do "put word 11 of line" && y && "of bg fld WCdata after bg fld temp_2DaysAfter"
  2335.   do "put cd bmp" && quote & word 13 of line y of bg fld WCdata & quote && "of card Icons into bg bmp icon_2DaysAfter"
  2336.   --select line 1 of bg fld temp_2DaysAfter
  2337.   --set the textcolor of bg fld temp_2DaysAfter to 79
  2338.   --set the textcolor of bg fld Tomorrow to 12
  2339.   --set the textfont of bg fld temp_2DaysAfter to Helvetica
  2340.   --set the textstyle of bg fld temp_2DaysAfter to bold
  2341.   --set the textalign of bg fld temp_2DaysAfter to center
  2342.   --set the textsize of bg fld temp_2DaysAfter to 16
  2343.   --select empty
  2344. end getForecast
  2345. -------------------------
  2346. -------------------------
  2347. on checkCity_cd gotocity
  2348.   global gWChilitedBtn
  2349.   if gotocity is not empty then
  2350.     send mouseLeave to cd btn gWChilitedBtn
  2351.     send mouseDown to cd btn gotocity
  2352.     put gotocity into gWChilitedBtn
  2353.   else
  2354.     beep
  2355.   end if
  2356. end checkCity_cd
  2357. -------------------------
  2358. on checkCity_bg gotocity
  2359.   global gWChilitedBtn
  2360.   if gotocity is not empty then
  2361.     send mouseLeave to bg btn gWChilitedBtn
  2362.     send mouseDown to bg btn gotocity
  2363.     put gotocity into gWChilitedBtn
  2364.   else
  2365.     beep
  2366.   end if
  2367. end checkCity_bg
  2368. -------------------------
  2369. on mouseHasBeenClicked
  2370.   --clearIdleAlarm
  2371.   repeat with i=1 to the number of bg timers
  2372.     stop bg timer i
  2373.   end repeat
  2374. --  stop bg snd "main"
  2375.   --repeat with i = 1 to the number of bg alarms  
  2376.   --  clear bg alarm i
  2377.   --end repeat
  2378.   --play stop
  2379.   if the visible of bg grp "Forecast" is "true" then
  2380.     send dismissPopup to bg btn "Continue"
  2381.   end if
  2382.   if the visible of cd btn "Help_BackToMap" is "true" then
  2383.     send dismissPopup to cd btn "Help_BackToMap"
  2384.   end if
  2385. end mouseHasBeenClicked
  2386. -------------------------
  2387. on clearforecast
  2388.   show bg grp "Forecast"
  2389.   put empty into bg fld "Tomorrow"
  2390.   put empty into bg fld "temp_Tomorrow"
  2391.   put empty into bg bmp "icon_Tomorrow"
  2392.   put empty into bg fld "1dayafter"
  2393.   put empty into bg fld "temp_1dayafter"
  2394.   put empty into bg bmp "icon_1dayafter"
  2395.   put empty into bg fld "2daysafter"
  2396.   put empty into bg fld "temp_2daysafter"
  2397.   put empty into bg bmp "icon_2daysafter"
  2398. end clearforecast
  2399. -------------------------
  2400. on emptybmps
  2401.   show bg grp day_bmps
  2402.   put empty into bg bmp Sunday
  2403.   put empty into bg bmp Monday
  2404.   put empty into bg bmp Tuesday
  2405.   put empty into bg bmp Wednesday
  2406.   put empty into bg bmp Thursday
  2407.   put empty into bg bmp Friday
  2408.   put empty into bg bmp Saturday
  2409. end emptybmps
  2410. -------------------------
  2411. --on copybgbmps name
  2412. --  repeat with i=3 to 10
  2413. --    do "put bg bmp" && quote & name & quote && "of cd 2 into bg bmp" && quote & name & quote && "of cd i"
  2414. --  end repeat
  2415. --end copybgbmps
  2416. -------------------------
  2417. --on copycdbmps name
  2418. --  repeat with i=3 to 10
  2419.  --   do "put cd bmp" && quote & name & quote && "of cd 2 into cd bmp" && quote & name & quote && "of cd i"
  2420.  -- end repeat
  2421. --end copycdbmps
  2422. 4+BiO
  2423. ZINFO
  2424. MapSCRP
  2425. on mouseUp
  2426.   --beep
  2427. end mouseUp
  2428. idleEXTI
  2429. 8INFO
  2430. Day_bmpsEXTI
  2431. )INFO
  2432. SundayEXTI
  2433. +INFO
  2434. MondayEXTI
  2435. -INFO
  2436. TuesdayEXTI
  2437. /INFO
  2438.     WednesdayEXTI
  2439. 1INFO
  2440. ThursdayEXTI
  2441. 3INFO
  2442. FridayEXTI
  2443. eyEX+TXT
  2444. keyEXTI
  2445. ForecasGRPO
  2446. vCARD
  2447. ForecastEXTI
  2448. ForecastEXTI
  2449. or+TXT
  2450. TomorrowEXTI
  2451.     1DayA+TXT
  2452.     1DayAfterEXTI
  2453. 2Days+TXT
  2454. 2DaysAfterEXTI
  2455. emp_+TXT
  2456. temp_TomorrowEXTI
  2457. _+TXT
  2458. temp_1DayAfterEXTI
  2459. temp_2DaysAfterEXTI
  2460. on_TomorrowEXTI+BiO
  2461. icon_TomorrowEXTI
  2462. _1DayAfterEXT+BiO
  2463. icon_1DayAfterEXTI
  2464. 2DaysAfterEX+BiO
  2465. icon_2DaysAfterEXTI
  2466.     DayOf+TXT
  2467.     DayOfWeekEXTI
  2468. iteEX+BiO
  2469. !INFO
  2470. Continue_hiliteEXTI
  2471. on mo+BUT
  2472. ContinueSCRP
  2473. on mouseUp
  2474.   global gWChilitedBtn
  2475.   global gNAVcdev
  2476.   global gWCcallingBtn
  2477.   global gWCcd_or_bg
  2478.   --  global gNAVEpcotPath
  2479.   global gWCpath
  2480.   --  global gWCvoicePath
  2481.   global gWCmainMusic
  2482.   global gPathAudio
  2483.   clearIdleAlarm
  2484.   play stop
  2485.   hide bg bmp "Continue_hilite"
  2486.   show bg bmp "Continue_hilite"
  2487.   hide bg bmp "Continue_hilite"
  2488.   show bg bmp "Continue_hilite"
  2489.   hide bg bmp "Continue_hilite"
  2490.   if gNAVcdev is "REMOTE" then
  2491.     send mouseLeave to bg btn gWChilitedBtn
  2492.     put gWCcallingBtn into gWChilitedBtn
  2493.     put "card" into gWCcd_or_bg
  2494.     send mouseDown to cd btn gWChilitedBtn
  2495.   else
  2496.     enable cd btn gWCcallingBtn of this card
  2497.   end if
  2498.   hide bg grp "Forecast"
  2499.   show grp "Cities"
  2500.   enableNavBtn
  2501.   -- ring bg alarm "alarmSelect" at 2100
  2502.   start bg timer "alarmSelect" expire in 2100 ticks
  2503.   --  play file (gNAVEpcotPath & gWCpath & gWCvoicePath & gWCmainMusic) nowait
  2504.   set the soundFile of bg snd "main" to 
  2505.       (gPathAudio & gWCmainMusic)
  2506.   play bg snd "main"
  2507. end mouseUp
  2508. -------------------------
  2509. on dismissPopup
  2510.   global gWChilitedBtn
  2511.   global gNAVcdev
  2512.   global gWCcallingBtn
  2513.   global gWCcd_or_bg
  2514. --  global gNAVEpcotPath
  2515.   global gWCpath
  2516.   global gWCvoicePath
  2517.   global gWCmainMusic
  2518.   global gPathAudio
  2519.   play stop
  2520.   hide bg bmp "Continue_hilite"
  2521.   if gNAVcdev is "REMOTE" then
  2522.     send mouseLeave to bg btn gWChilitedBtn
  2523.     put gWCcallingBtn into gWChilitedBtn
  2524.     put "card" into gWCcd_or_bg
  2525.     send mouseDown to cd btn gWChilitedBtn
  2526.   end if
  2527.   lock screen
  2528.   hide bg grp "Forecast"
  2529.   show grp "Cities"
  2530.   enableNavBtn
  2531.   unlock screen
  2532.   --ring bg alarm "alarmSelect" at 2100
  2533.   start bg timer "alarmSelect" expire in 2100 ticks
  2534.   --play file (gNAVEpcotPath & gWCpath & gWCvoicePath & gWCmainMusic) nowait
  2535.   set the soundFile of bg snd "main" to 
  2536.      (gPathAudio & gWCmainMusic)
  2537.   play bg snd "main"
  2538. end dismissPopup
  2539. -------------------------
  2540. on mouseDown
  2541.   --bgbuttonDown (the short name of me)
  2542.   do "show bg bmp" && quote & (the short name of me) & "_hilite" & quote
  2543. end mouseDown
  2544. -------------------------
  2545. on mouseLeave
  2546.   --bgbuttonLeave (the short name of me)
  2547.   do "hide bg bmp" && quote & (the short name of me) & "_hilite" & quote
  2548. end mouseLeave
  2549. downcity
  2550. leftbutton
  2551. leftcity
  2552. rightbutton
  2553.     rightcity
  2554. upcity
  2555. eypr+TXT
  2556. =INFO
  2557. keypressEXTI
  2558. EINFO
  2559. Help_hiliteEXTI
  2560. on mouseU+BUT
  2561. FINFO
  2562. HelpSCRP
  2563. on mouseUp
  2564.   global gWChilitedBtn
  2565.   global gNAVcdev
  2566.   --  global gNAVEpcotPath
  2567.   global gWCpath
  2568.   global gWCtriviaVoice
  2569.   global gWCvoicePath
  2570.   global gWCacceptMouseClicks
  2571.   global gWCcd_or_bg
  2572.   global gpathAudio
  2573.   if gWCacceptMouseClicks is not "false" then
  2574.     mouseHasBeenClicked
  2575.     send mouseLeave to bg btn (the short name of me)
  2576.     send mouseDown to bg btn (the short name of me)
  2577.     send mouseLeave to bg btn (the short name of me)
  2578.     send mouseDown to bg btn (the short name of me)
  2579.     send mouseLeave to bg btn (the short name of me)
  2580.     --ring bg alarm "alarmGoBack" at 1800
  2581.     start bg timer "alarmGoBack" expire in 1800 ticks
  2582.     --play file (gNAVEpcotPath & gWCpath & gWCvoicePath & gWCtriviaVoice) nowait
  2583.     stop bg snd "main"
  2584.     set the soundFile of bg snd "main" to 
  2585.     (gpathAudio& gWCtriviaVoice)
  2586.     set the bufferSize of bg snd "main" to 180
  2587.     set the playVolume of bg snd "main" to 100
  2588.     play bg snd "main"
  2589.     lock screen
  2590.     show cd btn "Help_BackToMap"
  2591.     if gNAVcdev is "REMOTE" then
  2592.       put "Card" into gWCcd_or_bg
  2593.       show cd bmp "Help_Remote"
  2594.       send mouseLeave to bg btn (the short name of me)
  2595.       send mouseDown to cd btn "Help_BackToMap"
  2596.     else
  2597.       show cd bmp "Help_Touch"
  2598.     end if
  2599.     unlock screen
  2600.     put "Help_BackToMap" into gWChilitedBtn
  2601.     disableNavBtn
  2602.   end if
  2603. end mouseUp
  2604. -------------------------
  2605. on mouseDown
  2606.   bgbuttonDown (the short name of me)
  2607. end mouseDown
  2608. -------------------------
  2609. on mouseLeave
  2610.   bgbuttonLeave (the short name of me)
  2611. end mouseLeave
  2612. downcity
  2613. leftbutton
  2614. leftcity
  2615. rightbutton
  2616.     rightcity
  2617. upcity
  2618. G+BiO
  2619. 5INFO
  2620. SaturdayEXTI
  2621. &INFO
  2622. GoBack_hiliteEXTI
  2623. :INFO
  2624. StartOver_hiliteEXTI
  2625. useClicks
  2626.     StartOverSCRP
  2627. on mouseUp
  2628.   global gWCpath
  2629.   global gWCnavApp
  2630.   global gNAVStackPath
  2631.   global gWCacceptMouseClicks
  2632.   if gWCacceptMouseClicks is not "false" then
  2633.     send mouseLeave to bg btn "StartOver"
  2634.     send mouseDown to bg btn "StartOver"
  2635.     send mouseLeave to bg btn "StartOver"
  2636.     send mouseDown to bg btn "StartOver"
  2637.     send mouseLeave to bg btn "StartOver"
  2638.     mouseHasBeenClicked
  2639.     go to card "Black"
  2640.     --go gNAVStackPath & gWCnavApp
  2641.     global gPomoPath
  2642.     lock screen
  2643.     go gPomoPath
  2644.   end if
  2645. end mouseUp
  2646. -------------------------
  2647. on mouseDown
  2648.   bgbuttonDown (the short name of me)
  2649. end mouseDown
  2650. -------------------------
  2651. on mouseLeave
  2652.   bgbuttonLeave (the short name of me)
  2653. end mouseLeave
  2654. downcity
  2655. leftbutton
  2656. GoBack
  2657. leftcity
  2658. rightbutton
  2659.     rightcity
  2660. upcity
  2661. 4EXTI
  2662. ;INFO
  2663. NextDay_hiliteEXTI
  2664.   global +BUT
  2665. NextDaySCRP
  2666. on mouseUp
  2667.   global gWCwhichday
  2668.   global gWCcurrCities
  2669.   global gWCtomorrow
  2670.   global gWCdate
  2671.   global gWCtomorrowdate
  2672.   global gNAVcdev
  2673.   global gWCacceptMouseClicks
  2674.   --  global gNAVEpcotPath
  2675.   --  global gWCpath
  2676.   global gWCvoicePath
  2677.   global gWCmainMusic
  2678.   global gpathAudio
  2679.   if gWCacceptMouseClicks is not "false" then
  2680.     mouseHasBeenClicked
  2681.     --    ring bg alarm "alarmSelect" at 2100
  2682.     start bg timer "alarmSelect" expire in 2100 ticks
  2683.     --play file (gNAVEpcotPath & gWCpath & gWCvoicePath & gWCmainMusic) nowait
  2684.     --set the soundFile of bg snd "main" to 
  2685.        (gpathAudio & gWCmainMusic) 
  2686.     --play bg snd "main"
  2687.     send mouseLeave to bg btn id 7
  2688.     send mouseDown to bg btn id 7
  2689.     send mouseLeave to bg btn id 7
  2690.     send mouseDown to bg btn id 7
  2691.     if gNAVcdev is not "REMOTE" then
  2692.       send mouseLeave to bg btn id 7
  2693.     end if
  2694.     if gWCwhichday is "today" then
  2695.       hide cd grp "Cities"
  2696.       put gWCtomorrow into gWCwhichday
  2697.       put gWCtomorrowdate into bg fld "DayOfWeek"
  2698.       putinNewData (the number of this card), gWCcurrCities, 3
  2699.       hide bg grp "Day_bmps"
  2700.       show cd grp "Cities"
  2701.     else
  2702.       hide cd grp "Cities"
  2703.       put "today" into gWCwhichday
  2704.       put gWCdate into bg fld "DayOfWeek"
  2705.       putinNewData (the number of this card), gWCcurrCities, 0
  2706.       show bg bmp gWCtomorrow
  2707.       show cd grp "Cities"
  2708.     end if
  2709.   end if
  2710. end mouseUp
  2711. -------------------------
  2712. on mouseDown
  2713.   bgbuttonDown (the short name of me)
  2714. end mouseDown
  2715. -------------------------
  2716. on mouseLeave
  2717.   bgbuttonLeave (the short name of me)
  2718. end mouseLeave
  2719. downcity
  2720. leftbutton
  2721. Region
  2722. leftcity
  2723. rightbutton
  2724. GoBack    rightcity
  2725. upcity
  2726. 2EXTI
  2727. HINFO
  2728. Region_hiliteEXTI
  2729. IINFO
  2730. GoToUpReg_hiliteEXTI
  2731. JINFO
  2732. GoToRightReg_hiliteEXTI
  2733. KINFO
  2734. GoToDownReg_hiliteEXTI
  2735. LINFO
  2736. GoToLeftReg_hiliteEXTI
  2737. he short+BUT
  2738. >INFO
  2739. RegionSCRP
  2740. on mouseUp
  2741.   global gNAVcdev
  2742.   if gNAVcdev is "REMOTE" then
  2743.     send mouseFlash to bg btn (the short name of me)
  2744.   else
  2745.     send mouseLeave to bg btn (the short name of me)
  2746.   end if
  2747. end mouseUp
  2748. -------------------------
  2749. on mouseDown
  2750.   global gNAVcdev
  2751.   global gWCvoicePath
  2752.   global gNAVEpcotPath
  2753.   global gWCpath
  2754.   global gWCmainMusic
  2755.   global gWCacceptMouseClicks
  2756.   if gWCacceptMouseClicks is not "false" then
  2757.     mousehasbeenclicked
  2758.     if gNAVcdev is "REMOTE" then
  2759.       put "Misc 19.3" into regBtnVoice
  2760.     else
  2761.       put "Misc 20.2" into regBtnVoice  
  2762.     end if
  2763.     ring bg alarm "alarmVoice" at 240
  2764.     play file (gNAVEpcotPath & gWCpath & gWCvoicePath & regBtnVoice) nowait
  2765.     bgbuttonDown (the short name of me)
  2766.   end if
  2767. end mouseDown
  2768. -------------------------
  2769. on mouseFlash
  2770.   bgbuttonDown (the short name of me)
  2771. end mouseFlash
  2772. -------------------------
  2773. on mouseLeave
  2774.   bgbuttonLeave (the short name of me)
  2775. end mouseLeave
  2776. downcity
  2777. leftbutton
  2778. leftcity
  2779. rightbutton
  2780. NextDay    rightcity
  2781. upcity
  2782. 1EXTI
  2783. ----------+BUT
  2784. ?INFO
  2785.     GoToUpRegSCRP
  2786. on mouseUp
  2787.   global gWCupReg
  2788.   GoToReg (the short name of me),gWCupReg
  2789. end mouseUp
  2790. -------------------------
  2791. on mouseDown
  2792.   lock screen
  2793.   bgbuttonDown (the short name of me)
  2794.   bgbuttonDown "Region"
  2795.   unlock screen
  2796. end mouseDown
  2797. -------------------------
  2798. on mouseLeave
  2799.   lock screen
  2800.   bgbuttonLeave (the short name of me)
  2801.   bgbuttonLeave "Region"
  2802.   unlock screen
  2803. end mouseLeave
  2804. mouseUp
  2805. -+BUT
  2806. @INFO
  2807. GoToRightRegSCRP
  2808. on mouseUp
  2809.   global gWCrightReg
  2810.   GoToReg (the short name of me),gWCrightReg
  2811. end mouseUp
  2812. -------------------------
  2813. on mouseDown
  2814.   lock screen
  2815.   bgbuttonDown (the short name of me)
  2816.   bgbuttonDown "Region"
  2817.   unlock screen
  2818. end mouseDown
  2819. -------------------------
  2820. on mouseLeave
  2821.   lock screen
  2822.   bgbuttonLeave (the short name of me)
  2823.   bgbuttonLeave "Region"
  2824.   unlock screen
  2825. end mouseLeave
  2826. -+BUT
  2827. AINFO
  2828. GoToDownRegSCRP
  2829. on mouseUp
  2830.   global gWCdownReg
  2831.   GoToReg (the short name of me),gWCdownReg
  2832. end mouseUp
  2833. -------------------------
  2834. on mouseDown
  2835.   lock screen
  2836.   bgbuttonDown (the short name of me)
  2837.   bgbuttonDown "Region"
  2838.   unlock screen
  2839. end mouseDown
  2840. -------------------------
  2841. on mouseLeave
  2842.   lock screen
  2843.   bgbuttonLeave (the short name of me)
  2844.   bgbuttonLeave "Region"
  2845.   unlock screen
  2846. end mouseLeave
  2847. ----+BUT
  2848. BINFO
  2849. GoToLeftRegSCRP
  2850. on mouseUp
  2851.   global gWCleftReg
  2852.   GoToReg (the short name of me),gWCleftReg
  2853. end mouseUp
  2854. -------------------------
  2855. on mouseDown
  2856.   lock screen
  2857.   bgbuttonDown (the short name of me)
  2858.   bgbuttonDown "Region"
  2859.   unlock screen
  2860. end mouseDown
  2861. -------------------------
  2862. on mouseLeave
  2863.   lock screen
  2864.   bgbuttonLeave (the short name of me)
  2865.   bgbuttonLeave "Region"
  2866.   unlock screen
  2867. end mouseLeave
  2868. hide+BUT
  2869. GoBackSCRP
  2870. on mouseUp
  2871.   global gWCacceptMouseClicks
  2872.   if gWCacceptMouseClicks is not "false" then
  2873.     hide bg bmp "GoBack_hilite"
  2874.     show bg bmp "GoBack_hilite"
  2875.     hide bg bmp "GoBack_hilite"
  2876.     show bg bmp "GoBack_hilite"
  2877.     hide bg bmp "GoBack_hilite"
  2878.     --breakpoint
  2879.     mouseHasBeenClicked
  2880.     hide cd grp "Cities" of cd "National"
  2881.     --get the playCounter of bg snd "main"
  2882.     --add 2 to it
  2883.     --    set the playEffects of bg snd "main" to "fadeout at""e& it"e& "for 3"
  2884.     --lock screen
  2885.     stop bg snd "main"
  2886.     visual effect iris close
  2887.     go to card "National"
  2888.     --hide cd shape "Black_back" of card "National"
  2889.     --hide cd bmp "Black_front" of card "National"
  2890.     --hide cd mov "Intro" of card "National"
  2891.     --show cd bmp "Day1_hide"
  2892.     --hide cd bmp "Day2_hide"
  2893.     --hide cd bmp "Day3_hide"
  2894.     --unlock screen
  2895.     --send openCard_call to card "National"
  2896.   end if
  2897. end mouseUp
  2898. -------------------------
  2899. on mouseDown
  2900.   bgbuttonDown (the short name of me)
  2901. end mouseDown
  2902. -------------------------
  2903. on mouseLeave
  2904.   bgbuttonLeave (the short name of me)
  2905. end mouseLeave
  2906. downcity
  2907. leftbutton
  2908. NextDay
  2909. leftcity
  2910. rightbutton    StartOver    rightcity
  2911. upcity
  2912. 3EXTI
  2913. PINFO
  2914. CoverBadObjsEXTI
  2915. Popup to bg btTMER
  2916. QINFO
  2917. alarmGoBackSCRP
  2918. on timerExpired 
  2919.   if the visible of bg btn "Continue" is true then  
  2920.     send dismissPopup to bg btn "Continue"
  2921.   else if the visible of cd btn "Help_BackToMap" is true then
  2922.     send dismissPopup to cd btn "Help_BackToMap"
  2923.   end if
  2924. end timerExpired
  2925. RINFO
  2926. alarmSelectSCRP
  2927. on timerExpired
  2928. --  global gNAVEpcotPath
  2929.   global gWCpath
  2930.   global gWCvoicePath
  2931.   global gWCselectVoice,gPathAudio
  2932.   --ring bg alarm "alarmVoice" at 180
  2933.   start bg timer "alarmVoice" expire in 180 ticks
  2934.   --play file (gNAVEpcotPath & gWCpath & gWCvoicePath & gWCselectVoice) nowait
  2935. --  set the soundFile of bg snd "main" to 
  2936. --     (gPathAudio & gWCselectVoice)
  2937. --  play bg snd "main"
  2938. end timerExpired
  2939. end timTMER
  2940. SINFO
  2941. alarm_loseClicksSCRP
  2942. on timerExpired
  2943.   global gWCacceptMouseClicks
  2944.   put "true" into gWCacceptMouseClicks
  2945. end timerExpired
  2946. WCvoicePath,gPaTMER
  2947. TINFO
  2948. alarmVoiceSCRP
  2949. on timerExpired
  2950. --  global gNAVEpcotPath
  2951.   global gWCpath
  2952.   global gWCregMusic
  2953.   global gWCvoicePath,gPathAudio
  2954.   --ring bg alarm "alarmSelect" at 1200
  2955.   --start bg timer "alarmSelect" expire in 1200 ticks
  2956.   --play file (gNAVEpcotPath & gWCpath & gWCvoicePath & gWCregMusic) nowait
  2957.   set the soundFile of bg snd "main" to 
  2958.       (gPathAudio & gWCregMusic)
  2959.   play bg snd "main"
  2960. end timerExpired
  2961. VINFO
  2962. Gigi:POMOCD:Presenting OMO 
  2963. :exhibits:Audio:TchUSmsc.aif
  2964. mainEXTI
  2965. 0    52+TXT
  2966. WINFO
  2967. wcDataEXTI
  2968. 95/6/10 13.55                                                            
  2969. ABQ    40    62    B    38    55    MTSVR    40    52    SCSSW    32    54    SUN    31    59    SUN
  2970. ABR    35    55    U    35    54    SCSW    35    45    AMRS    25    45    SUN    25    45    SUN
  2971. ACY    35    57    E    34    57    SUN    36    64    SUN    46    64    VCLDY    49    63    SHW
  2972. ALB    26    52    N    26    52    SUN    36    56    PC    37    56    SCSW    46    53    SHW
  2973. ALO    31    55    U    42    57    SCSW    45    57    SHW    35    45    PC    26    47    SUN
  2974. AMA    35    59    U    43    59    PMTRW    45    56    AMSHW    35    56    SUN    32    63    SUN
  2975. APN    21    46    U    35    55    PC    44    56    SHW    44    52    SHW    35    44    WNDY
  2976. ATL    52    69    R    45    66    PC    46    66    PC    55    75    SCSW    48    65    AMSHW
  2977. BGR    25    48    N    25    49    PC    30    53    PC    37    56    VCLDY    45    54    SHW
  2978. BHM    54    67    W    48    73    PC    49    73    PC    55    74    SCTRW    47    65    AMSHW
  2979. BIS    33    55    U    35    47    SCSW    26    44    PC    25    44    SUN    25    45    PC
  2980. BNA    44    63    C    45    65    PC    47    72    PC    54    65    SCSW    44    57    PC
  2981. BNO    20    37    J    26    44    VCLDY    17    43    PC    18    43    PC    25    44    MTSVR
  2982. BOI    36    49    W    30    44    SSHW    23    43    SUN    22    44    SUN    21    44    SCSW
  2983. BOS    29    51    B    32    55    SUN    35    59    PC    43    62    VCLDY    47    56    SHW
  2984. BRL    34    55    U    44    64    VCLDY    45    64    SHW    42    52    PC    33    53    SUN
  2985. BRO    60    74    E    65    85    PC    65    85    SCTRW    71    83    SCTRW    55    74    PC
  2986. BTV    25    44    j    24    47    PC    35    55    VCLDY    36    55    SHW    45    46    SHW
  2987. BUF    30    49    B    31    55    SUN    43    63    SPMSW    45    56    SHW    45    46    WNDY
  2988. BZN    21    39    E    25    34    RS    15    38    SUN    15    42    SUN    21    37    VCLDY
  2989. CAE    49    80    W    40    65    PC    43    65    PC    47    74    PC    54    66    AMSHW
  2990. CAR    25    39    j    24    45    PC    26    46    PC    35    55    SCSW    45    54    SHW
  2991. CHA    46    66    W    44    66    PC    45    66    PC    54    72    SCSW    45    60    PC
  2992. CHS    55    83    W    46    65    PC    46    65    PC    52    75    PC    63    73    SCTRW
  2993. CLE    30    54    B    35    63    SUN    44    64    SPMSW    45    62    SHW    43    53    WNDY
  2994. CLT    43    71    W    36    65    SUN    37    65    PC    46    69    VCLDY    47    65    AMSHW
  2995. COS    34    58    B    33    54    SCSW    25    43    AMSHW    24    46    SUN    24    54    SUN
  2996. CSG    55    75    T    48    69    PC    48    70    PC    55    75    SCSW    55    66    AMSHW
  2997. CVG    34    57    B    40    65    SUN    45    65    VCLDY    54    63    SHW    36    55    PC
  2998. CYS    32    57    B    34    52    SCSW    24    39    AMSHW    23    44    SUN    24    53    SUN
  2999. DCA    36    60    E    32    56    SUN    36    64    SUN    46    65    VCLDY    46    58    SHW
  3000. DEN    34    56    B    34    54    SCSW    25    43    AMSHW    24    47    SUN    24    54    SUN
  3001. DFW    42    63    U    54    74    VCLDY    60    74    SHW    49    65    AMSHW    37    65    SUN
  3002. DLH    29    47    U    35    55    SCSW    37    46    SHW    32    37    PC    26    43    PC
  3003. DRT    45    67    U    55    76    SCSW    62    74    SCTRW    52    66    AMSHW    42    65    SUN
  3004. DSM    35    55    U    44    60    SCSW    45    57    SHW    34    46    PC    26    54    SUN
  3005. DTW    29    52    U    35    62    PC    45    64    SCSW    45    55    SHW    42    48    WNDY
  3006. ELP    46    70    B    44    64    SCSW    44    64    PC    36    64    SUN    35    64    SUN
  3007. ELY    18    43    J    19    39    SSHW    19    38    SUN    15    46    SUN    18    49    PC
  3008. EUG    34    48    B    35    46    VCLDY    32    44    SCSW    35    46    R    35    44    SHW
  3009. EWR    35    56    B    29    56    SUN    35    61    SUN    45    63    VCLDY    47    56    SHW
  3010. EYW    75    85    B    74    85    ISTRW    74    85    PC    74    85    ISTRW    74    85    ISTRW
  3011. FAR    35    54    U    35    54    SCSW    35    45    AMRS    25    44    SUN    25    45    SUN
  3012. FAT    45    56    W    44    56    VCLDY    36    63    PC    36    64    PC    44    63    SCSW
  3013. FLG    28    49    N    30    51    SHW    32    52    PC    19    50    SUN    26    56    PC
  3014. FMY    67    88    B    67    84    PC    66    84    PC    67    85    ISTRW    66    84    ISTRW
  3015. FSD    35    55    U    35    55    SCSW    39    47    AMRS    25    45    SUN    25    48    SUN
  3016. FWA    29    55    U    36    64    PC    45    65    SCSW    46    55    SHW    36    47    PC
  3017. GCK    35    56    U    36    56    PMTRW    39    54    AMSHW    33    55    SUN    25    55    SUN
  3018. GDV    28    54    B    26    45    SCSW    25    42    PC    24    45    SUN    25    45    PC
  3019. GEG    26    40    LCW    25    39    VCLDY    25    37    PC    25    43    PC    26    40    MTSVR
  3020. GFK    33    53    U    35    53    SCSW    35    44    AMRS    25    42    SUN    25    44    PC
  3021. GJT    39    60    E    32    50    RS    31    46    PC    22    44    SUN    22    52    PC
  3022. GTF    27    47    E    27    35    RS    23    43    SUN    23    43    PC    24    43    VCLDY
  3023. HOU    47    67    E    58    76    PC    64    82    SCSW    64    73    SCTRW    46    66    PC
  3024. IND    31    56    U    42    65    PC    45    65    SCSW    52    56    SHW    35    52    PC
  3025. INL    30    46    U    35    55    SCSW    35    45    SHW    26    36    PC    25    37    PC
  3026. ISN    33    55    U    27    45    SCSW    25    37    PC    25    45    SUN    25    45    PC
  3027. JAX    64    84    B    55    67    FSHW    55    74    PC    59    77    PC    64    75    SCTRW
  3028. LAS    42    59    LCW    42    63    PC    45    63    PC    39    65    SUN    41    65    PC
  3029. LAX    55    64    W    48    63    PC    53    62    PC    55    71    PC    52    73    PC
  3030. LBB    36    65    U    45    62    PMTRW    45    62    AMSHW    36    59    SUN    34    64    SUN
  3031. LBF    35    55    U    35    55    SCSW    34    46    AMSHW    25    47    SUN    18    55    SUN
  3032. LEX    35    60    E    43    65    SUN    46    66    PC    54    65    SHW    38    55    PC
  3033. LIT    45    58    E    54    74    PC    55    74    SCSW    54    65    SCSW    37    65    PC
  3034. LSE    28    54    U    36    55    SCSW    45    55    SHW    35    44    PC    26    45    PC
  3035. LWS    36    44    LCW    26    44    VCLDY    24    43    SUN    27    44    PC    27    44    SCSW
  3036. MAF    39    65    U    45    65    PMTRW    49    65    PC    41    64    PC    35    64    SUN
  3037. MCI    40    55    U    45    64    SCSW    47    63    SHW    36    55    PC    33    55    SUN
  3038. MEM    45    63    C    54    73    PC    54    74    VCLDY    55    65    SCSW    44    64    PC
  3039. MIA    74    85    B    74    85    ISTRW    73    85    FSHW    74    85    ISTRW    73    85    ISTRW
  3040. MLS    29    54    B    26    45    SCSW    25    44    PC    23    45    SUN    25    45    PC
  3041. MOB    61    77    T    56    74    PC    59    75    PC    64    75    SCTRW    55    68    AMSHW
  3042. MQT    26    46    U    35    55    VCLDY    43    54    SHW    35    36    AMRS    35    41    WNDY
  3043. MSP    32    51    U    35    55    SCSW    44    48    SHW    28    44    PC    25    45    SUN
  3044. MTN    34    59    E    31    56    SUN    36    63    SUN    46    65    VCLDY    46    58    SHW
  3045. NEW    59    76    T    58    75    PC    64    76    PC    64    75    SCTRW    55    68    AMSHW
  3046. NGP    51    73    B    64    84    PC    65    84    SCTRW    65    75    SCTRW    52    72    PC
  3047. OMA    35    55    U    43    56    SCSW    44    55    SHW    27    47    SUN    26    54    SUN
  3048. ORD    31    55    U    40    64    PC    45    64    SHW    45    52    SHW    35    46    PC
  3049. ORF    43    64    LCW    37    64    PC    40    65    SUN    51    68    PC    54    66    SHW
  3050. ORL    65    86    B    65    81    FSHW    64    77    PC    65    84    ISTRW    65    80    SCTRW
  3051. PAH    41    63    E    47    65    PC    54    74    SPMSW    54    63    SCSW    37    56    PC
  3052. PDX    37    50    B    33    45    VCLDY    32    44    SCSW    35    45    R    35    43    SHW
  3053. PFN    62    79    LCT    56    75    PC    58    75    PC    64    77    SCSW    56    74    SCTRW
  3054. PFN    no data        no data    no data    56    75    PC    58    75    PC    64    76    SCTRW    56    73
  3055. PHL    34    57    B    32    56    SUN    36    63    SUN    45    64    VCLDY    46    59    SHW
  3056. PHX    51    73    N    48    64    AMSHW    48    67    PC    47    72    SUN    50    76    PC
  3057. PIH    32    48    W    21    41    MTSVR    15    40    SUN    19    42    SUN    21    43    VCLDY
  3058. PIR    38    55    U    35    54    SCSW    31    45    PC    25    45    SUN    24    49    SUN
  3059. PIT    29    53    B    31    61    SUN    41    63    PC    45    64    SHW    45    55    PC
  3060. PSP    50    71    LCW    52    70    PC    53    71    PC    51    72    SUN    50    75    PC
  3061. PWM    26    50    N    26    53    PC    33    55    PC    39    56    VCLDY    45    54    SHW
  3062. RAP    36    59    U    33    53    SCSW    25    43    PC    24    45    SUN    23    52    SUN
  3063. RDU    37    69    LCW    35    64    SUN    36    65    SUN    46    73    PC    49    65    SHW
  3064. RIC    35    61    LCW    34    59    SUN    36    65    SUN    46    68    VCLDY    46    63    SHW
  3065. RKS    28    49    N    20    40    S    22    38    SCSSW    19    39    SUN    19    45    PC
  3066. RNO    29    40    J    24    42    VCLDY    23    42    SUN    22    47    PC    26    43    VCLDY
  3067. ROA    36    62    LCW    28    60    SUN    36    64    SUN    46    66    PMSHW    45    61    AMSHW
  3068. SAC    42    55    W    44    61    VCLDY    36    61    PC    35    63    PC    44    55    SCSW
  3069. SAN    54    64    W    48    66    PC    54    65    PC    54    74    PC    53    75    PC
  3070. SAT    47    71    U    57    81    VCLDY    64    76    SCTRW    57    67    SCSW    45    65    PC
  3071. SAV    60    82    LCW    50    66    PC    47    66    PC    55    75    PC    63    74    SCTRW
  3072. SEA    37    49    B    31    42    VCLDY    29    43    SCSW    34    42    R    34    42    SHW
  3073. SFO    45    58    W    49    64    VCLDY    47    64    PC    43    64    PC    44    63    SCSW
  3074. SGF    40    56    B    46    65    VCLDY    54    67    SHW    45    55    AMSHW    35    57    SUN
  3075. SHR    29    54    B    26    44    SCSW    21    42    PC    14    44    SUN    21    45    PC
  3076. SHV    45    62    E    55    74    PC    62    75    SCSW    56    66    SCSW    45    65    PC
  3077. SLC    35    60    W    27    42    RS    22    39    PC    20    41    SUN    21    43    PC
  3078. SSI    61    84    W    54    66    PC    50    71    PC    56    76    PC    64    75    SCTRW
  3079. SSM    24    46    U    35    55    PC    42    55    SHW    37    42    AMRS    35    37    WNDY
  3080. STL    42    56    B    47    65    PC    52    71    SHW    51    55    AMSHW    35    55    SUN
  3081. SUX    35    55    U    39    55    SCSW    43    53    SHW    26    46    SUN    25    54    SUN
  3082. SYR    29    47    N    26    55    SUN    37    57    VCLDY    44    56    SHW    45    46    WNDY
  3083. TOP    36    55    U    45    64    SCSW    47    60    SHW    35    55    PC    33    55    SUN
  3084. TPH    24    45    LCW    31    46    VCLDY    31    45    SUN    25    52    SUN    27    57    PC
  3085. TRI    37    63    W    34    65    SUN    38    65    PC    47    66    SCSW    45    57    PC
  3086. TUL    45    54    U    51    65    VCLDY    54    66    SHW    43    56    AMSHW    35    63    SUN
  3087. UIL    35    46    B    38    47    VCLDY    41    44    SCSW    40    44    R    38    44    SHW
  3088. oice, gwcmaiTMER
  3089. YINFO
  3090. openSCRP
  3091. on timerExpired
  3092.   global gWCplayedRegVoice
  3093.   global gPathAudio, gWCregVoice
  3094.   global gwcplayedRegVoice, gwcmainmusic
  3095.   --answer "you Freak!"
  3096.   --breakpoint
  3097.   if gWCplayedRegVoice is "false" then
  3098.     start bg timer "alarmVoice" expire in 1200 ticks
  3099.     if the isplaying of bg snd "main" is false then      
  3100.       set the soundFile of bg snd "main" to (gPathAudio & gWCregVoice)
  3101.       set the bufferSize of bg snd "main" to 180
  3102.       set the playVolume of bg snd "main" to 100
  3103.       play bg snd "main"
  3104.       put "true" into gWCplayedRegVoice
  3105.     end if
  3106.   else
  3107.     start bg timer "alarmSelect" expire in 1200 ticks
  3108.     if the isplaying of bg snd "main" is false then      
  3109.       set the soundFile of bg snd "main" to 
  3110.         (gPathAudio & gWCmainmusic)
  3111.       set the bufferSize of bg snd "main" to 180
  3112.       set the playVolume of bg snd "main" to 100     
  3113.       play bg snd "main"
  3114.     end if
  3115.   end if
  3116. end timerExpired
  3117. +TAIL
  3118. -INFO
  3119.     NorthEastSCRP
  3120. on openCard
  3121.   global gWCcurrCities
  3122.   global gWCmacities
  3123.   --  global gWCmacitiesInit
  3124.   global gNAVcdev
  3125.   global gWCtomorrow
  3126.   global gWC1dayafter
  3127.   global gWC2daysafter
  3128.   global gWCdate
  3129.   global gWCbtnToCityNav
  3130.   global gWCRegNav
  3131.   global gWCacceptClickDelay
  3132.   global gWCregVoice, gPathAudio, gWCmainmusic
  3133.   initializeCard
  3134.   put empty into gWCmacities
  3135.   put "Albany ALB 4"&return&
  3136.    "AtlanticCity ACY 3"&return&
  3137.    "Bangor BGR 9"&return&
  3138.    "Boston BOS 15" &return&
  3139.    "Buffalo BUF 19" &return&
  3140.    "Burlington BRL 16"&return&
  3141.    "NewYorkCity EWR 41" &return&
  3142.    "Philadelphia PHL 87" &return&
  3143.    "Pittsburgh PIT 91" into gWCnecities
  3144.   put gWCmacities into gWCcurrCities
  3145.   hide cd grp "Cities"
  3146.   put "today" into gWCwhichday
  3147.   put gWCdate into bg fld "DayOfWeek"
  3148.   putinNewData (the number of this card), gWCcurrCities, 0  
  3149.   show bg bmp gWCtomorrow
  3150.   show cd grp "Cities"
  3151.   put empty into gWCbtnToCityNav
  3152.   put "Region Pittsburgh" into line 1 of gWCbtnToCityNav
  3153.   put "NextDay Philadelphia" into line 2 of gWCbtnToCityNav
  3154.   put "GoBack AtlanticCity" into line 3 of gWCbtnToCityNav
  3155.   put "StartOver AtlanticCity" into line 4 of gWCbtnToCityNav
  3156.   put "Help Bangor" into line 5 of gWCbtnToCityNav
  3157.   put empty into gWCRegNav
  3158.   global gWCupReg,gWCrightReg,gWCdownReg,gWCleftReg
  3159.   put "none" into line gWCupReg of gWCRegNav
  3160.   put "none" into line gWCrightReg of gWCRegNav
  3161.   put "MidAtlantic" into line gWCdownReg of gWCRegNav
  3162.   put "GreatLakes" into line gWCleftReg of gWCRegNav
  3163.   if gNAVcdev is "REMOTE" then
  3164.     showInitialLoc
  3165.   end if
  3166.   enableNavBtn
  3167.   --ring bg alarm "alarm_loseClicks" at gWCacceptClickDelay
  3168.   start bg timer "alarm_loseClicks" expire in gWCacceptClickDelay ticks
  3169.   start bg timer open expire in 1 seconds
  3170. end openCard
  3171. =GRPO
  3172. 9INFO
  3173. -CARD
  3174. cities_hilitedata
  3175. 8TAIL
  3176. %INFO
  3177. ;CARD
  3178. Albanydata
  3179. $TAIL
  3180. WCARD
  3181. Burlingtondata
  3182.     TAIL
  3183. Bangordata
  3184. -CARD
  3185. Citiesdata
  3186. #TAIL
  3187. &INFO
  3188. AtlanticCitydata
  3189. #TAIL
  3190. $CARD
  3191. Philadelphiadata
  3192. ~GRPO
  3193. Pittsburghdata
  3194. Bostondata
  3195. Buffalodata
  3196. NewYorkCitydata
  3197. 'INFO
  3198. NewYorkCitydata
  3199. 666w<66w
  3200. 66]666]
  3201. ",)21
  3202. kJ]]w6IIr]!
  3203. kDkDkDI
  3204. ~~{~{ss
  3205. kIADl
  3206. <]f]f]r
  3207. 663%%
  3208. u]+!!!!!
  3209. HFHFS
  3210. 44A7A?4?2A
  3211. +++-2++4
  3212. N.466$
  3213. 2+!!!+!!!+2
  3214. SJJ_d_n
  3215. qAG:~
  3216. !!!!!568
  3217. uu~~~~u
  3218. JAA]<6
  3219. ytvlv
  3220. }{            
  3221. nvy{p
  3222.         y        
  3223. nlyyvl{
  3224. vtttt
  3225. *TAIL
  3226. v+BiO
  3227. )INFO
  3228. Bostondata
  3229. P<66f
  3230. k!66]
  3231. k.66]
  3232. y7y{>
  3233. fk%k{EH;
  3234.     ]Nf]fN-
  3235. 666666$
  3236. IfI"6
  3237. 666666(
  3238. .6&&&6
  3239. "66&6E
  3240. "&&&6.
  3241. k666/<66D
  3242. 666666!
  3243. $TAIL
  3244. +INFO
  3245. Bangordata
  3246. kDkDa
  3247. qy7yq
  3248. .."{i7sUG....
  3249. $$".$
  3250. $$$$$
  3251. 666666(
  3252. 6&&&6""
  3253. D666r
  3254. ssszx}vv
  3255. kwDkDI
  3256. kJArIr
  3257. 24555
  3258. 54515
  3259. )TAIL
  3260. -INFO
  3261. Burlingtondata
  3262. CrCrCtAJEJLMJH
  3263. tyvl<:
  3264. hCvr ::
  3265. ::.lE\H0
  3266. L\fF*
  3267. E)>f\0
  3268. RRRR%
  3269. A<6666666]]]]]
  3270. P]P]AAAAr]r]r
  3271. ]]<666666
  3272. aaaaa
  3273. LyvrCLHCLl%V
  3274. tytkw}gYjyj{D
  3275. ay$...
  3276. ]666k
  3277. :4::4:5
  3278. qy7yy
  3279. Bfff*
  3280. ,7yUU
  3281. Uy=sUU
  3282. BhhhhhhpX<X
  3283. (6&&&666666666666666
  3284. "&&&6.
  3285. 666666A
  3286. 2BB[X 4
  3287. 666".
  3288. K~Z***
  3289. !TAIL
  3290. /INFO
  3291. Albanydata
  3292. X=C=-666
  3293. ~~~~~,
  3294. .666"
  3295. ~~~~~
  3296. -r]]<
  3297. w66<w666
  3298. 6666666666
  3299. .6&&&
  3300. 6&&&6.
  3301. 6&&&6""
  3302. 6666666666
  3303. r<6<]
  3304. q77=F
  3305. -AAA]
  3306. p}}}k
  3307. (TAIL
  3308. 1INFO
  3309. AtlanticCitydata
  3310. k666]
  3311. gOXR6
  3312. <<<<=
  3313. tyttr
  3314. rireXUUUiXXc
  3315. NNEEN<<<21.0.
  3316. NKKXKXXXXUUUUUUUUUUUXKKKKXUU
  3317. tkrXUUU
  3318. NPNPJ<820.0
  3319. XXUUUUUUXKXXKOK::NNNKO
  3320. KMMC!
  3321. ?2224?
  3322. 2222332?2?
  3323. MJMJMJ
  3324. fffopppppTc
  3325. (pkiX
  3326. `ddd`M
  3327. UGGUUUUUUUU
  3328. tkkXKXKXkXTiXcccX
  3329. XUUUUXXi
  3330. kpkkkkkk
  3331. XXXXiXXXiXXk
  3332. rXXUXUUXUUUU
  3333. G@G@GAGA@ASGGOGOOUAGSASGASUGOSGS@UOUUOUAAGGUOUUASAGAGAUOXXXUikiUUOUXXXXU@UOASSSAGUAUUUSUUUAGSASAAGUAGGGGO
  3334. GG@G@G@GGGAUAS@AG@GUAGAGASGOAG@AAUU@UG@AUAUUU@USUAUAGGGUOAUOXXXUUUOUUUUASAGUOAUGOGASASUUAUSAGUGUGUGUUUSAG
  3335. GG@G@GU@@GGAGG@G@G@G@@G@AAG@AGS@GAGAGAGSG@UAAGUAUAAGAGOAG@UAUUUUSAAGAGAAGAGGAUAGOAAGGO@OUGGAGGSGGAGU@GSS@A
  3336. G@G@@AGGAG@GGG@AAGGAGA@AGU@GGAAUAGAGUGAGAAGAGU@GAG@GSA@GAOGSU@U@ASG@SASASG@ASOGA@UGAAG@GAGGGG@SGUGGAGAUAGG
  3337. GA@AGAG@AG@A@GAGG@@AG@G@UO@U@OGG@SAGAG@G@GG@GAG@AG@@AAG@O@AS@AGAGGAAGAGAG@G@GAGAGAGASAS@GGAGAAG@U@AGGAGASG@
  3338. 1TAIL
  3339. 3INFO
  3340. Buffalodata
  3341.  _VQz
  3342. $ZFFb
  3343. K~.p~
  3344. gK"p~~~
  3345. }}ppp\TNN:21.)$...11<E<<<<:<::ENKNck
  3346. }pfffNNE<55..))..).<JJE<:<<::NNTcTk
  3347. ffffPNE<<<811..155<EPNE<<<E:N\cckc
  3348. ~p~h~t|bZZUZ$
  3349. XcZ227?.
  3350. p&gs7
  3351. f\PN<1111.5<<EJPPPPPP\PNEJPNcc}k
  3352. JEF]4
  3353. 13zhUX
  3354. -]+}Naa
  3355. ?47247?m
  3356. 3d=222[d=2**r/
  3357. 468:6
  3358. 222222222
  3359. ???2M
  3360. {y7yq
  3361. bIb`Q
  3362. ???????&
  3363. U?227X((_L_LMCLCLC=Mm*3=33$$$p
  3364. sssss`ss
  3365. sssss
  3366. +++T++
  3367. +TAIL
  3368. 5INFO
  3369. Pittsburghdata
  3370.     =.,,
  3371. ++++++4_X
  3372. .L+++++t1
  3373. hhfh.Ewywy
  3374. 1Ewyw
  3375. 11EEEEEE
  3376. 5$$66
  3377. fy7yqU
  3378.                     
  3379. 88;8888
  3380. 8;888;
  3381. ;888;g_dg_dF;8_dggdgL
  3382. ~_LJS$z___tnJJ?nZ
  3383. "y_d__
  3384. A<666
  3385. 8;88;
  3386.     8"-$
  3387.     1                
  3388. ?&-~    
  3389.     8            
  3390.     8                
  3391. p}wwkDkDkDkDkDkDk
  3392. ''%..
  3393. -TAIL
  3394. ?$"+BiO
  3395. 7INFO
  3396. Philadelphiadata
  3397. 66<p<6
  3398. "."..$
  3399. r<66D
  3400. kkkE/
  3401. P]<6fk
  3402. ]<<6k
  3403. D<66f
  3404. O<66k
  3405. 66666
  3406. 66666
  3407. 8686868
  3408. 66888
  3409. 888888
  3410. 86888888888888886
  3411. +TAIL
  3412. 6INFO
  3413. Pittsburgh_hilitedata
  3414.     %%    ,
  3415. 9<66k
  3416. Xssss`X`
  3417. LggbgqLq
  3418. Is`gg
  3419.                     
  3420. IN</J
  3421. U-+AU
  3422. INIJ^
  3423. 888        
  3424. 8888    81
  3425. ;8;;;
  3426. ///]r
  3427. /]/c]c]
  3428. ]cIzI
  3429. ////{
  3430. ewIwII
  3431. ;;;;;;
  3432. ;8;;;
  3433. 8_dg_
  3434. AAAp3
  3435. -AAANf]f]f]f]f]fIIIIIIIIIY
  3436. DDFFDFWFDDs
  3437. AZ%Pk~m
  3438. WWWFD|
  3439. DW_Wb_sbszz|
  3440. 4INFO
  3441. Buffalo_hilitedata
  3442. `\h`\M\``M\\M\PhPP\\\`\fhff`hffhfhfh}o}p}
  3443. 2$+/XFBBXR
  3444. 2$+/BFBpbii
  3445. & /Xdbi
  3446. :+BFBdbi
  3447. ,pg@rKs
  3448. gGrkg
  3449. p)P"d~~~\
  3450. 5~HO@Kg
  3451. ~~~~~~~~~~~
  3452. Wip"X)"p~~~~~~
  3453. ~~~~~~~~~~
  3454. ~~~~~~~
  3455. ~~~~~~~
  3456. 1,i~X
  3457. ~~~~~~~~
  3458. ~~~~~~~~~~~~~~~~~~~
  3459. ~~~~~~
  3460. ~~~p~
  3461. ~~~~~
  3462. ~~~~~p~~
  3463. ~~~~~p
  3464. ~~~p~~~~~
  3465. ___qx
  3466. kfccT:111....115:<<<:<<<<NNPNNN}
  3467. >-f~SS
  3468. C=CM~p~
  3469. x_gx<
  3470. C=~q~
  3471. ''''    
  3472. |XX~pp~~
  3473. +.+2&||X
  3474. 66<]]]A
  3475. aaaw]P
  3476. E6##}q
  3477. N]<66!KgK
  3478. <///c//]e
  3479. /;8/]]]/////]////c/r]/;8/]O]
  3480. ]]/;I///c]]c
  3481. fgff_
  3482. #TDQg
  3483. `J???
  3484. lMCL6
  3485. sssss
  3486. sssss
  3487. 666.AAAY
  3488. ssssss
  3489. mULL!
  3490. A]<6wk
  3491. >=8~VCg272
  3492. 8=8s^CX+72
  3493. +="sUC\
  3494. s+27A
  3495. ]]<!kk
  3496. &-~rXV
  3497. +4??X<66w
  3498. ssss)-~~WV
  3499. <&.,.
  3500. NTAIL
  3501. .INFO
  3502. Burlington_hilitedata
  3503. \\\Z\>C>>
  3504. ::::::::
  3505. 66666
  3506. :::::4<
  3507. 7777O{7
  3508. 7E7{r>,
  3509. ^{^{>
  3510. *X<66D
  3511. ~~~~~
  3512. g@rKs
  3513. ~~~~X
  3514. p)P"d~~~X"~gKs
  3515. 5,p~~~~~~~~~~~~~~$3*
  3516.     ~~~~~~~~~~~
  3517. ~~~~~~~~~~~~~~
  3518. ~~~~~~~~~~
  3519. \piWs
  3520. ~~~~~~~
  3521. ~~~~~~~~~~~
  3522. ~~~&d
  3523. ~~~~~~
  3524. ~~~~~~~~~~~
  3525. 0INFO
  3526. Albany_hilitedata
  3527. p~hC=C{<66f
  3528. ~~~~~0
  3529. (~~~~~~~
  3530. ~~~~~
  3531. i"3MC=
  3532. ,,,~~~
  3533. ~~~~~~
  3534. ^NlIw
  3535. ,]cII
  3536. ~~~~~~
  3537. ^^`^`?^
  3538. {^`^`^{^`^%
  3539. IIc]c<],`]cIwJkIw]
  3540. p~p~~~
  3541. pp~ph
  3542. l]xcl``%
  3543. N777y
  3544. Uy\=ys
  3545. ,INFO
  3546. Bangor_hilitedata
  3547.     MSQS
  3548. ]<66k
  3549.                         
  3550. a}6]!
  3551. kjkjj
  3552. /$]AJa
  3553. kececd
  3554. <<]I<</(66D
  3555. 6<l<6<}<66w
  3556. *    6/i/~
  3557. sdddeek
  3558. dddecdje
  3559. ddddcekj
  3560. {'',T
  3561. 4{=ddddee
  3562. 2$$/W{
  3563. 41ccddddbdb
  3564. ,ddddekkeb
  3565. ddddekj
  3566. 24555
  3567. sz}}vv
  3568. /<G(/
  3569. ,?`?,
  3570. D"6</(66k
  3571. 666666666666]P
  3572. **300CC>>HFHFXZXZZZZZZf\\f\\f\
  3573. sz}vv
  3574. 7451/
  3575. ETAIL
  3576. *INFO
  3577. Boston_hilitedata
  3578. Dk!<-
  3579. kkkkkkkaa
  3580. AakkkkkkkkkDkDkDkDkDkDkDkD]!
  3581. r<6<]IIIIIII]
  3582. NNIIIIIIIIfIfIfIfIfIfIf]r
  3583. P<66l
  3584. f"<<P
  3585. k666pAAAp3
  3586. 7>1/m
  3587. d..06
  3588. k!66]
  3589. D666a
  3590. HXZZ>06*
  3591. k666]
  3592. Xf..(
  3593. ^IkI`
  3594. ^`'ccc
  3595. {EL0    
  3596. /////c,
  3597. ];;;IE`r
  3598. 6<}66
  3599. 81<.<
  3600. 07777<5
  3601. 6w<66A<66
  3602. f"66G"]A
  3603. kJ]]w6IIr]!
  3604. kDkDkDI
  3605. ~~{~{ss
  3606. kIADl
  3607. <IfIfIr
  3608. u]+!!!!!
  3609. HFHFS
  3610. ETAIL
  3611.     /(o+BiO
  3612. (INFO
  3613. NewYorkCity_hilitedata
  3614. k666/<66D
  3615. 666666!
  3616. +.8***
  3617. 07777<5
  3618. &<<iKNN
  3619. ^^BB((
  3620. E,,,,,,
  3621. ,JNAA++"
  3622. }#/7#
  3623.     ^-;###8J^
  3624. 5-U]]A]
  3625. ..,..
  3626. ]--/--
  3627. 9]F]--]-
  3628. ''?=iiki
  3629. 1."1"
  3630. ///////////
  3631. {rc]c]c]]
  3632. nlyyvl{
  3633. vtttt
  3634. vvvtl
  3635. tntnvv
  3636.             yl
  3637. >TAIL
  3638. 2INFO
  3639. AtlanticCity_hilitedata
  3640. O<66k
  3641. k"66]
  3642. 72?23
  3643. f77=\yUDI
  3644. --8444!
  3645. 2-a888
  3646. gaaAL
  3647. ks6^I
  3648. 5:DJy
  3649. ....*
  3650. ==========M
  3651. !@GAGX
  3652. kG@AG@@@@@@@@AGAG@@G@A@@@@@@@@@@G@@GGGAG@AG@@AAGAG@@AG@@AGUG@@@@@@GAG@G@@GGAG@G@@G@@@G@GAGGAG@GAG@AG@@@@GAG@@@@AGAGG@
  3653. =TAIL
  3654. 8INFO
  3655. Philadelphia_hilitedata
  3656. ]<66k
  3657. ^`^?^`
  3658. {^',,,,
  3659. {^',,,^
  3660. Ic](IGT
  3661. {E$////^
  3662. %I$///y
  3663. {,,,,^
  3664. l////r
  3665. ?^%',T
  3666. E&$/W^
  3667. N\A]ak
  3668. N\a}a
  3669. ]c;7IwwJ,/]wIw]l?E/c
  3670. ,^``^
  3671. A<66w
  3672.     uuuuu~u
  3673. ~u~uu
  3674. 888282:
  3675. {~s~{~
  3676. -a888
  3677. 00gg`
  3678. `s`ssssss
  3679. sssss
  3680. 00000
  3681. ;ttDPtt$
  3682. 8tqtL
  3683. Attm5
  3684. OttdOtt
  3685. taOtm~d+24
  3686. ;;;;;;;;;;;;
  3687. .8>>>8>>
  3688. ;;;;;;
  3689. 8>88>8
  3690. @@@_qO
  3691. C]DSX_D
  3692. x2+4L
  3693. HTAIL
  3694. Buffalo_icondata
  3695. 6VV0V66
  3696. iTV=g
  3697. VT3Ti
  3698. =!=!3!3!!!!!=!3==
  3699. "INFO
  3700. Albany_icondata
  3701. Burlington_icondata
  3702. Pittsburgh_icondata
  3703. 6VV0V66
  3704. iTV=g
  3705. VT3Ti
  3706. =!=!3!3!!!!!=!3==
  3707. Philadelphia_icondata
  3708. 6VV0V66
  3709. iTV=g
  3710. VT3Ti
  3711. =!=!3!3!!!!!=!3==
  3712. !INFO
  3713. AtlanticCity_icondata
  3714. H!33H
  3715. NewYorkCity_icondata
  3716. 6VV0V66
  3717. iTV=g
  3718. VT3Ti
  3719. =!=!3!3!!!!!=!3==
  3720. Boston_icondata
  3721. 6VV0V66
  3722. iTV=g
  3723. VT3Ti
  3724. =!=!3!3!!!!!=!3==
  3725.  INFO
  3726. Albanydata
  3727. 52/26ADDD
  3728. Burlingtondata
  3729. 55/34ADDD
  3730. Buffalodata
  3731. 49/30ADDD
  3732. Pittsburghdata
  3733. 53/29ADDD
  3734. Philadelphiadata
  3735. 57/34ADDD
  3736. Bangordata
  3737. 48/25ADDD
  3738. Bostondata
  3739. 51/29ADDD
  3740. $]AJa
  3741. NewYorkCitydata
  3742. 56/35ADDD
  3743. AtlanticCitydata
  3744. 57/35ADDD
  3745. $INFO
  3746. AlbanySCRP
  3747. on mouseUp
  3748.   cityButtonPush (the short name of me)
  3749. end mouseUp
  3750. -------------------------
  3751. on mouseDown
  3752.   cityButtonDown (the short name of me)
  3753. end mouseDown
  3754. -------------------------
  3755. on mouseLeave
  3756.   cityButtonLeave (the short name of me)
  3757. end mouseLeave
  3758. citycode
  3759. downcity
  3760. Philadelphia
  3761. leftcity
  3762. Buffalo    rightcity
  3763. Boston
  3764. upcity
  3765. BurlingtonTAIL
  3766.     INFO
  3767. BurlingtonSCRP
  3768. on mouseUp
  3769.   cityButtonPush (the short name of me)
  3770. end mouseUp
  3771. -------------------------
  3772. on mouseDown
  3773.   cityButtonDown (the short name of me)
  3774. end mouseDown
  3775. -------------------------
  3776. on mouseLeave
  3777.   cityButtonLeave (the short name of me)
  3778. end mouseLeave
  3779. citycode
  3780. downcity
  3781. Albany
  3782. leftcity
  3783. Buffalo    rightcity
  3784. Bangor
  3785. upcity
  3786. Button HelpTAIL
  3787. BuffaloSCRP
  3788. on mouseUp
  3789.   cityButtonPush (the short name of me)
  3790. end mouseUp
  3791. -------------------------
  3792. on mouseDown
  3793.   cityButtonDown (the short name of me)
  3794. end mouseDown
  3795. -------------------------
  3796. on mouseLeave
  3797.   cityButtonLeave (the short name of me)
  3798. end mouseLeave
  3799. citycode
  3800. downcity
  3801. Pittsburgh
  3802. leftcity
  3803. Pittsburgh    rightcity
  3804. Albany
  3805. upcity
  3806. BurlingtonTAIL
  3807. PittsburghSCRP
  3808. on mouseUp
  3809.   cityButtonPush (the short name of me)
  3810. end mouseUp
  3811. -------------------------
  3812. on mouseDown
  3813.   cityButtonDown (the short name of me)
  3814. end mouseDown
  3815. -------------------------
  3816. on mouseLeave
  3817.   cityButtonLeave (the short name of me)
  3818. end mouseLeave
  3819. citycode
  3820. downcity
  3821. Button Region
  3822. leftcity
  3823.     rightcity
  3824. Philadelphia
  3825. upcity
  3826. BuffaloTAIL
  3827. PhiladelphiaSCRP
  3828. on mouseUp
  3829.   cityButtonPush (the short name of me)
  3830. end mouseUp
  3831. -------------------------
  3832. on mouseDown
  3833.   cityButtonDown (the short name of me)
  3834. end mouseDown
  3835. -------------------------
  3836. on mouseLeave
  3837.   cityButtonLeave (the short name of me)
  3838. end mouseLeave
  3839. citycode
  3840. downcity
  3841. Button NextDay
  3842. leftcity
  3843. Pittsburgh    rightcity
  3844. NewYorkCity
  3845. upcity
  3846. AlbanyTAIL
  3847. BangorSCRP
  3848. on mouseUp
  3849.   cityButtonPush (the short name of me)
  3850. end mouseUp
  3851. -------------------------
  3852. on mouseDown
  3853.   cityButtonDown (the short name of me)
  3854. end mouseDown
  3855. -------------------------
  3856. on mouseLeave
  3857.   cityButtonLeave (the short name of me)
  3858. end mouseLeave
  3859. citycode
  3860. downcity
  3861. Boston
  3862. leftcity
  3863. Burlington    rightcity
  3864. Button Help
  3865. upcity
  3866. Button HelpTAIL
  3867. BostonSCRP
  3868. on mouseUp
  3869.   cityButtonPush (the short name of me)
  3870. end mouseUp
  3871. -------------------------
  3872. on mouseDown
  3873.   cityButtonDown (the short name of me)
  3874. end mouseDown
  3875. -------------------------
  3876. on mouseLeave
  3877.   cityButtonLeave (the short name of me)
  3878. end mouseLeave
  3879. citycode
  3880. downcity
  3881. NewYorkCity
  3882. leftcity
  3883. Albany    rightcity
  3884. Button Help
  3885. upcity
  3886. BangorTAIL
  3887. RRRNXRR
  3888. NewYorkCitySCRP
  3889. on mouseUp
  3890.   cityButtonPush (the short name of me)
  3891. end mouseUp
  3892. -------------------------
  3893. on mouseDown
  3894.   cityButtonDown (the short name of me)
  3895. end mouseDown
  3896. -------------------------
  3897. on mouseLeave
  3898.   cityButtonLeave (the short name of me)
  3899. end mouseLeave
  3900. citycode
  3901. downcity
  3902. AtlanticCity
  3903. leftcity
  3904. Philadelphia    rightcity
  3905. upcity
  3906. BostonTAIL
  3907. #INFO
  3908. AtlanticCitySCRP
  3909. on mouseUp
  3910.   cityButtonPush (the short name of me)
  3911. end mouseUp
  3912. -------------------------
  3913. on mouseDown
  3914.   cityButtonDown (the short name of me)
  3915. end mouseDown
  3916. -------------------------
  3917. on mouseLeave
  3918.   cityButtonLeave (the short name of me)
  3919. end mouseLeave
  3920. citycode
  3921. downcity
  3922. Button GoBack
  3923. leftcity
  3924. Philadelphia    rightcity
  3925. upcity
  3926. NewYorkCityTAIL
  3927. <INFO
  3928. Help_Touchdata
  3929. RuA{    
  3930. D27Rc
  3931. RuAg^
  3932.  tgAV
  3933. Pq/=76
  3934. co0?S
  3935.     5677
  3936.     2577
  3937. 7(((    (((>
  3938. ((((((((
  3939. &(((>
  3940. 3(((3
  3941.     2557
  3942. {At,R
  3943. 6Ruto
  3944. =//=?
  3945. A21&c
  3946. t>k31
  3947. b21&o
  3948. co0?S
  3949. ]    &C9
  3950. {%9bB
  3951. ((((((((
  3952. 6666M
  3953. {{{t[wwK
  3954.         2567
  3955. 5??        
  3956. 66666
  3957. ((-J}}i
  3958. }}U<9(
  3959. ((<J}}
  3960. j}}l?((
  3961. J}}}6
  3962. 9(<[}}Q
  3963. }l?((
  3964. J}}}}|||6
  3965. ((>lUUUU}}k9
  3966. i}EUUUUD<((
  3967. P~K}-
  3968. ((<[}}i
  3969. k}}J>((
  3970. G9~(~9G
  3971. s\HK8!567
  3972. <=<=&
  3973. SSSSSS
  3974. 28-5E
  3975. OG2Kuy4
  3976. J!''!
  3977. 6K6c6
  3978. GFSSSSSSSSSSSSSS
  3979. 4"9>II}Y
  3980. }M{%Y.
  3981. _IIQ#4
  3982. ^``uuuuuuuuuuuuuu
  3983. 4)i>^>
  3984. rcYe    MP
  3985. SP(SSQc
  3986. 1'4p4
  3987. x(g7rg6w?8
  3988.         256
  3989. &q:(((:6,75*
  3990. 9&<5od
  3991. ?>?>>?>?>>?>?>?;
  3992. TfRNuuWrftJnsk|hh~srXu
  3993. Ri.i-
  3994. o(~XZ~XZ~XZ~XZ
  3995. $LN~ZX~ZX~ZX(~
  3996.         ?277
  3997. 9(<l}}Q9
  3998. 9(}cD
  3999. kE}J>((
  4000.         2267
  4001. CBCBCCC@@@@@@CCCC@@C@@@@@@@@@@C@C
  4002. ((>l}}
  4003. 8'(GiAy
  4004. 9j}}l?9(
  4005. vm~(&
  4006. ((>J}}
  4007. 8i}}U<9(
  4008. ((<}}}i
  4009. }l?((
  4010. ((.J}
  4011. }}J>((
  4012. ((>U}}k
  4013. mmmmmlmmlml2l5l2555
  4014. mmmmlmlml2l5l25555
  4015. mmmmmlmlml2l2l25555
  4016. mmmmmml|mlmlml2l2l#l555555555$55555$55$555555$5555555$5555
  4017. Y=?45
  4018. =445    
  4019. ^Y_YYY_Y
  4020. =?44    
  4021. =445    
  4022. XYXYY
  4023. YXYYYY
  4024. XYXYXYXXYXY
  4025. Y^^YXY^^
  4026. Y^^^^
  4027. ?5677
  4028. YXXXY
  4029. ?5567
  4030. HHIHH
  4031. SSSSSSSSSSSSSSSS
  4032. ^uuuuuuuuuuuuuuuu
  4033. eII---
  4034. edddde
  4035. ?=^^==d
  4036. =d=dd
  4037. =:^XY
  4038. >?>?>?>?>?>?>??
  4039. Y^YXX
  4040. 4RSRg
  4041. 6RSXe
  4042.         2577
  4043.         2577
  4044. _Y^^^
  4045. 6.m]X
  4046. XYXY_
  4047. _YXXY^^^^
  4048. 7662            
  4049. 7652    
  4050. 56666665
  4051. *+**?
  4052. }JUUUUUUUUUUUUUUUUUJUJJJJJJJJ
  4053. XXXXN
  4054. GGXNNQNXNXXXXX
  4055. XXXXX
  4056. X6XnXN
  4057. XXXXX
  4058. XXnXX
  4059. XXXnX
  4060. SSSSSSSSSSSSSSSS
  4061. Kuuuuuuuuuuuuuuuu
  4062. *+*+:(
  4063. UJUJU
  4064. QXQfx)(>(
  4065. >QQX\tky&33
  4066. >>346    >??>?>>
  4067. >?>?>?>?>>?>?>?;
  4068. GNQX-;:,
  4069.     ?257
  4070. GQGN-:,:
  4071.         2577
  4072. JJJGXNXQ
  4073. Gy6Ny
  4074. QXGQ)>,:B
  4075.         2577R'&x`'&x3
  4076. yu'7x3
  4077. F&&"u&&33
  4078. XNfnXXfN
  4079. XNNXn
  4080. XGGGG
  4081. XXXXXXX
  4082. XXXXXXXXXXXX
  4083. =<%jjt,t,t,t,vtvtvtvt,tt,t,t,t,t,t,v,t,,t,,v,.:;
  4084. >=)??<
  4085. )>mn+1lv
  4086. 77>(/
  4087. /(9>>(
  4088. (>>(9&?x.'
  4089. ??((?
  4090. ?((44((:%((:
  4091. 3(:/3)
  4092. >((7>
  4093. >&((/    ?x.'
  4094. 0??-(
  4095. >9:    .(
  4096. >(9>>((>
  4097. A7>((
  4098. 9(((((((
  4099. &&7&&7~
  4100. &&<=<&<=<&
  4101. <&<=<&
  4102. <&<=<&
  4103. &&97&&
  4104. Y7d^>v
  4105. ~~o~~~o
  4106. ~&~7~~
  4107. ~~o~X~X
  4108. 99999
  4109. 99&9&&
  4110. &X&~o
  4111. &BKg|>&
  4112. X&&&~X
  4113. ><=<7
  4114. }JlZ7Bh@|
  4115. ~&7~&
  4116. &X&&~~XZ
  4117. <=<7666
  4118. io&&&X
  4119. &999&&
  4120. 7dA$|
  4121. d9&XX
  4122. f7B7_
  4123. f,N&'
  4124. >3477
  4125. o&&7&
  4126. &=&<5
  4127. <=&<<
  4128. ~o~&p
  4129. SSSSSSSSWSSSSSSS
  4130. Wuuuuuuuu`uuuuuuu
  4131. ~o~&X
  4132. )o&&o~
  4133. `&&\7
  4134. Xg||$=
  4135.         2577
  4136. &9&9&&&~
  4137. >?>?>?>?>>?>?>?>k&O
  4138. >2<=<
  4139. &7&&&&
  4140. ~o|AZ
  4141. &=&&<=
  4142. R3<((
  4143. >%<((%
  4144. 3(((3((%<((%
  4145. (((3(
  4146. (((    (
  4147. (3(()
  4148. =((?>((>?((
  4149. (>?((
  4150. (((((
  4151. ((977(.
  4152. ~&&&X
  4153. 'o~~'
  4154. =<<44
  4155.         ?277
  4156. *+*+:(
  4157. }5}lKmHX
  4158. X7~Xo~X~
  4159. &=<&=<&<=
  4160. ?>>>3477
  4161.         2267
  4162. ((((((((
  4163. 7652        
  4164. 988^^
  4165. ^^9^x^
  4166. =>            
  4167. =''='=='==
  4168. dGY'=d]
  4169. `d='=
  4170. ~]d''=~
  4171. ]='='
  4172. ??<267
  4173. B==''
  4174. e0$>=
  4175. SSSSSSSSSSSSSSSS
  4176. vdY^'8
  4177. Wuuuuuuuuuuuuuuuu
  4178. `&&\7
  4179. ^^Yn0
  4180.     c:9^^Y    
  4181. ^$2~Y?
  4182. n34of`^|0Y^
  4183. "Z:n 
  4184. [8&_~0}^^'_|["9_
  4185. _9_9^[|_
  4186. fo`_^
  4187. >?>?>?>?>>?>?>?>k&O
  4188. 8_9X^'^g^^g
  4189. _9_'^8X^
  4190. ^8_&_
  4191. ^8_9_8^
  4192. _9_8_
  4193. 8_8^9
  4194. 8_9_8^~=
  4195. ^8_'^
  4196. `X`X`X~X `X]
  4197. `e` Y
  4198. ]X]X`:
  4199. Y`X]X`:
  4200. 7R&&&
  4201. [Za^S
  4202. kSRSkQkQkQkRRk
  4203.     2257
  4204. S7&x`'&x"
  4205. 7&33&&33
  4206. ce`;;#
  4207. &&((&&((
  4208. W&&>W&
  4209. u&&&S
  4210. &&((&&((
  4211. (&&((
  4212. >&&(7
  4213. &&((&`
  4214. {|kmFkp
  4215. &&(9&&((
  4216. (&&9(
  4217. (&7((
  4218. &&((&u
  4219. <9&&<(
  4220. {g(:Be
  4221. 15567
  4222. 9%$34477
  4223. *+**?
  4224. 12257
  4225. P9sE9
  4226.         2577
  4227. rj{,62
  4228. =<;78
  4229. N**;d
  4230.     5567
  4231. ^^g99999(wNM\5D
  4232. ^X***r
  4233. 9oNMM
  4234. {{OA++AP7
  4235. 9gg^|
  4236. &&33'Q
  4237. hD'&i3
  4238. BM{P+
  4239. B{RBBi
  4240. {ig7^^
  4241. W&&&q
  4242. SSSSSSSSSSSSSSSW
  4243. R''&&&&&u
  4244. &7&&&&
  4245. 7('&&79(3
  4246. *+*+:
  4247. 9$Q#M
  4248. DLQQ    
  4249. aja1^
  4250. {Bs^!D3
  4251. >?>?>?>?>>?>?>?;
  4252. 7S&&&
  4253. X3DDIw
  4254. 99P9ii
  4255. 7(((    (({
  4256. &(((>
  4257. k&&&M
  4258. B&&&u
  4259. >&&(&
  4260. >&&(7
  4261. 9>+,33#32
  4262. ivt!!.$<=3=
  4263. <393%3
  4264. &&((&&
  4265. &7((7&
  4266. (&&((
  4267. (&7{Y
  4268. 3<(>>((7>
  4269. >&((&        
  4270. :)3>>
  4271. 77>(>
  4272. >((>>(
  4273. (>>(9&?x.'
  4274. ((?3(
  4275. :(:    ?    4
  4276. )>>((>
  4277. ((77    
  4278.     ((:7
  4279. :(:    ?    4
  4280. <;;2<
  4281. )>>)%
  4282. >?9???(?
  4283. >(((    (((7
  4284. 3(((3
  4285. >(((7
  4286. 4>?>>>347
  4287. ;+*+:
  4288.         2267
  4289.         2577
  4290.     2257
  4291.     2257
  4292.     2567
  4293. *+*+:(
  4294. 77777
  4295. 67777
  4296. =INFO
  4297. Help_Remotedata
  4298. RuA{    
  4299. XzRuAg^    
  4300. RuAg^    
  4301. RuA{    
  4302. {uA9c
  4303.     5577
  4304. )(%B}
  4305.     2557
  4306.     2557
  4307. 3(((3
  4308. (>34477
  4309. RuAgbo
  4310.     5577
  4311. 8S3%8S34
  4312. 0"*813
  4313. cSbZi
  4314. <%X/1
  4315. =//=>
  4316. A21&c
  4317. )?(z*
  4318. 6666666666666
  4319. (((?((9>
  4320.         2567
  4321. 66666
  4322. (((((9((
  4323. (9(((((9
  4324. ((<J}}i
  4325. }}U<((
  4326. *+**?(
  4327. ((<J}}
  4328. j}}l.((
  4329. J}}}6
  4330. (9<J}}Q
  4331. }l?((
  4332. J}}}7
  4333. ((>l}}k9
  4334. i}}U-((
  4335. P~K}-
  4336. (9<J}}i
  4337. k}}J>(9
  4338. PJKK-766
  4339. ((<l}Ei
  4340. Q}EJ-((
  4341. G9~(~9G
  4342. s\HK8!567
  4343. <=<=&
  4344. SSSSSS
  4345. 28-5E
  4346. Ss?Q=
  4347. S==SS
  4348. es?S=
  4349. uBBH=    ?557
  4350. J!''!
  4351. 6K6c6
  4352. GFSSSSSSSSSSSSSS
  4353. 4"9>II}Y
  4354. }M{%Y.
  4355. _IIQ#4
  4356. ^``uuuuuuuuuuuuuu
  4357. 4)i>^>
  4358. rcYe    MP
  4359. SP(SSQc
  4360. 1'4p4
  4361. g7rg6w?8
  4362.         256
  4363. &q:(((:6,75*
  4364. 9&<5od
  4365. ?>?>>?>?>>?>?>?;
  4366. TfRNuuWrftJnsk|hh~srXu
  4367. Ri.i-
  4368. o(~XZ~XZ~XZ~XZ
  4369. $LN~ZX~ZX~ZX(~
  4370.         ?277
  4371. 9(<l}}Q9
  4372. 9(}cD
  4373. kE}J/((
  4374.         2267
  4375. 7523    
  4376. 9(<J}}i
  4377. !coQ9
  4378. }J/((
  4379. ((>l}}
  4380. 8'(GiAy
  4381. 9j}}l?((
  4382. vm~(&
  4383. (9<l}}i
  4384. }l?((
  4385. ((?J}
  4386. }}J/((
  4387. *+**?(
  4388. ((>UUUU
  4389. k}}UUUU
  4390. *+*++
  4391. Y:,55
  4392. ^^XY^
  4393. ^Y_YYY_Y
  4394. =?44    
  4395. =444    
  4396. =444    
  4397. =444    
  4398. =444    
  4399. Y^^^XXY^^^
  4400. ^^^^^YXY^^Y
  4401. XY_YXY^
  4402. Y^^^YXY_Y
  4403. XY^^^^^
  4404. YXY^^^^YX
  4405. ^^^Y_YX
  4406. Y^^^^
  4407. YYYXY
  4408. HHIHH
  4409. SSSSSSSSSSSSSSSS
  4410. ^uuuuuuuuuuuuuuuu
  4411. eII---
  4412. edddde
  4413. ?=^^==d
  4414. =d=dd
  4415. =:^XY
  4416. >?>?>?>?>?>?>??
  4417. 4    SRSZ
  4418. XXXYY
  4419. 5RSRg
  4420.     ?257
  4421.     ?257
  4422. 53(>(
  4423. (((43(((    
  4424. ((:&7:(9
  4425.     (9(3
  4426. ((    (((>
  4427. ((    (((/7:(9
  4428.     (((3
  4429. ((>?(9    (?
  4430. 4RSRg
  4431. 6RSXe
  4432.         2577
  4433.         2577
  4434. _Y^^^
  4435. 6.m]X
  4436. XYXY_
  4437. _YXXY^^^^
  4438. 7??_SR
  4439. RQRRQ
  4440. 66.[X
  4441. SRSRRRRRSRRSRRQRS
  4442. RRQRQ
  4443. 7652    
  4444. 56666665
  4445. }JUUUUUUUUUUUUUUUUUJUJJJJJJJJ
  4446. XXXXN
  4447. GGXNNQNXNXXXXX
  4448. XXXXX
  4449. X6XnXN
  4450. &&&>&&&>
  4451. >&7C>39
  4452. d&&ud&
  4453. u((&&((
  4454. &&&&&C
  4455. XXnXX
  4456. XXXnX
  4457. SSSSSSSSSSSSSSSS
  4458. nXXXX
  4459. QNGf2:&
  4460. R&&&u
  4461. (&&((
  4462. ::!=        2577
  4463. '&-/'
  4464. >?>?>?>?>>?>?>?;
  4465.         2477
  4466. ((:74<((
  4467.     /((7
  4468. >9((    
  4469. (    ((%
  4470. >(((    (
  4471. )((    9(
  4472. (((((9(
  4473. GNQX-;:,
  4474.     ?257
  4475. GQGN-:,:
  4476.         2577
  4477. JJJGXNXQ
  4478. Gy6Ny
  4479. QXGQ)>,:B
  4480.         2577R'&x`'&x3
  4481. yu'7x3
  4482. F&&"u&&33
  4483. GQQN$>;:
  4484.     ?257
  4485. 9&&((
  4486. XNNXn
  4487. XGGGG
  4488. XXXXXXX
  4489. XXXXXXXXXXXX
  4490. =<%jjt,t,t,t,vtvtvtvt,tt,t,t,t,t,t,v,t,,t,,v,.:;
  4491. >=)??<
  4492. )>mn+1lv
  4493. 77>(/
  4494. /(9>>(
  4495. (>>(9&?x.'
  4496. ??((?
  4497. ?((44((:%((:
  4498. 3(:/3)
  4499. >((7>
  4500. >&((/    ?x.'
  4501. 0??-(
  4502. >9:    .(
  4503. >(9>>((>
  4504. A7>((
  4505. 9(((((((
  4506. &&7&&7~
  4507. &&<=<&<=<&
  4508. <&<=<&
  4509. <&<=<&
  4510. &&97&&
  4511. Y7d^>v
  4512. ~~o~~~o
  4513. ~&~7~~
  4514. &X@gZ$
  4515. X~Xo&X
  4516. &9&7&&
  4517. &BKg|>&
  4518. X&&&~X
  4519. ><=<7
  4520. }JlZ7Bh@|
  4521. ~&7~&
  4522. &X&&~~XZ
  4523. <=<7666
  4524. io&&&X
  4525. &999&&
  4526. 7dA$|
  4527. d9&XX
  4528. >7BA5<
  4529. 9?=    2577
  4530. o&&7&
  4531. &=&<5
  4532. <=&<<
  4533. ~o~&p
  4534. SSSSSSSSWSSSSSSS
  4535. Wuuuuuuuu`uuuuuuu
  4536. ~o~&X
  4537. )o&&o~
  4538. lJk~g|
  4539.     ?25/
  4540. 7^M37^
  4541. S&&xl&&
  4542. &7((7&
  4543. 8X&u)
  4544. &&((&
  4545. 'V&u)
  4546. io~&X
  4547. ~&~X~&
  4548. &9&9&&&~
  4549. >?>?>?>?>>?>?>?>k&
  4550. >2<=<
  4551. &7&&&&
  4552. ~X~7~Bh$&=&&
  4553. X&&7&&
  4554. &&&X~$
  4555. ~&&&X
  4556. 'o~~'
  4557. =<<44
  4558.         ?277
  4559. X&~&7~9
  4560. &&9&G
  4561. X~o~o~X~m~BhgZgg|ZZK%v
  4562. $Z$?$
  4563.         2267
  4564. ((((((((
  4565. 7652        
  4566. ^^&Y^Y
  4567. =?            6
  4568. %        66
  4569. 88^'d
  4570. ]=='=
  4571. ]'='=d
  4572. &??5567
  4573. B=d'=
  4574. SSSSSSSSSSSSSSSS
  4575. Wuuuuuuuuuuuuuuuu
  4576. 63n:Y
  4577. B!>dB
  4578. `&&\7
  4579. Z*>5=
  4580. e&_^~    &_
  4581. =|^^O2
  4582. 88X n
  4583. o0f^^h0Y
  4584. Y[7X4|XZ0
  4585. _&_|0
  4586. '^[o6o]_&_
  4587. ^f|^io^9_
  4588. >?>?>?>?>>?>?>?>k&
  4589. ^Y^g^
  4590. _9_9_
  4591. 8_9:d
  4592. ^8^^9_
  4593. ^gYX9X9
  4594. XY`X]^`e
  4595. `XY`e`Y`eY
  4596. `X`e`:d
  4597. __98'_9_
  4598. Y'''Y
  4599. ''=d'=
  4600. 7R&&&
  4601. gnmbY^f\
  4602. kStS]
  4603. 7752        
  4604.     2257
  4605. S7&x`'&x"
  4606. 7&33&&33
  4607. B7&&d
  4608. W&&&q
  4609. O'7&i
  4610. [->=v
  4611. W&&>W&&>
  4612. u&&&S
  4613. &&((&&((
  4614. (&&((
  4615. >&&(7
  4616. &&((&`
  4617. {|kmFkp
  4618. &&(9&&((
  4619. (&&9(
  4620. (&7((
  4621. &&((&u
  4622. &&99'&n
  4623. <9&&<(
  4624. p988H
  4625. 15567
  4626. {$34477
  4627. 42567
  4628. "    2577
  4629. 12257
  4630. C^^g99
  4631. ^ACz$ZBmw:
  4632.         2577
  4633. N**;d
  4634.     5567
  4635. *+*+:(
  4636. 99gg^
  4637. NwttB
  4638. z4477
  4639. 9^X***r
  4640. 9oNMM
  4641. N89(v{$
  4642. {{OA++AP7
  4643. 9gg^|
  4644. &&33'Q
  4645. hD'&i3
  4646. {M{P+
  4647. B{RBBi
  4648. {ig7^^
  4649. W&&&q
  4650. SSSSSSSSSSSSSSSW
  4651. C^w7[#
  4652. S&&&u
  4653.     &&70
  4654. 6&&(&
  4655. DL7@    
  4656. >?>?>?>?>>?>?>?;
  4657. 77651"
  4658. 9xM~G
  4659. "(((3((%<((%
  4660. (((7(((3(
  4661. ((    (((>
  4662. (((33(((    
  4663. )((    (
  4664. ((3<((
  4665. 4(>3(((
  4666. 7S&&&
  4667. +.'^g
  4668. X3DDIw
  4669. 7(((    (({
  4670. &(((>
  4671. 9!N))
  4672. :"{99
  4673. >&&(&
  4674. >&&(7
  4675. 9>+,33#32
  4676. ivt!!.$<=3=
  4677. <393%3
  4678. &&((&&
  4679. &7((7&
  4680. (&&((
  4681. (&7{Y
  4682. >?9???(?
  4683. >(((    (((7
  4684. 3(((3
  4685. >(((7
  4686.     0257
  4687.         2577
  4688.     2257
  4689. ?INFO
  4690. Help_BackToMap_hilitedata
  4691. >(()K
  4692. K=((>
  4693. :[[Fa
  4694. dYY==d
  4695. =='=d
  4696. u63Z=Y
  4697. 9/%Y4=%
  4698. 9~Y70
  4699. Y3?d^
  4700. ^x^^&2
  4701. -_    5%
  4702. 2|^^O 
  4703. oY^^i0
  4704. ^Y[n6[
  4705. YoZ^^
  4706. 0|_'^
  4707. Z4o0]
  4708. fo^9^Krd^[_
  4709. 8_8_9
  4710. ^9^^^`X
  4711. YOX`}X~XY`
  4712. Y`X]^
  4713. X `e`e`e
  4714. *TAIL
  4715. BINFO
  4716. Help_BackToMapSCRP
  4717. on mouseUp
  4718.   global gWChilitedBtn
  4719.   global gNAVcdev
  4720.   global gWCcd_or_bg
  4721.   --  global gNAVEpcotPath
  4722.   global gWCpath
  4723.   global gWCvoicePath
  4724.   global gWCmainMusic
  4725.   global gpathAudio
  4726.   clearIdleAlarm
  4727.   play stop
  4728.   send mouseLeave to cd btn (the short name of me)
  4729.   send mouseDown to cd btn (the short name of me)
  4730.   send mouseLeave to cd btn (the short name of me)
  4731.   send mouseDown to cd btn (the short name of me)
  4732.   send mouseLeave to cd btn (the short name of me)
  4733.   lock screen
  4734.   if gNAVcdev is "REMOTE" then
  4735.     hide cd bmp "Help_Remote"
  4736.   else
  4737.     hide cd bmp "Help_Touch"
  4738.   end if
  4739.   hide cd btn "Help_BackToMap"
  4740.   unlock screen
  4741.   enableNavBtn
  4742.   put "Help" into gWChilitedBtn
  4743.   if gNAVcdev is "REMOTE" then
  4744.     put "Background" into gWCcd_or_bg
  4745.     send mouseDown to bg btn "Help"
  4746.   end if
  4747.   start cd timer "alarmSelect" of cd "National" expire in 2100 ticks
  4748.   --play file (gNAVEpcotPath & gWCpath & gWCvoicePath & gWCmainMusic) nowait
  4749.   set the soundFile of bg snd "main" to 
  4750.      (gPathAudio & gWCmainMusic)
  4751.   play bg snd "main"
  4752. end mouseUp
  4753. -------------------------
  4754. on dismissPopup
  4755.   global gWChilitedReg
  4756.   global gNAVcdev
  4757.  -- global gNAVEpcotPath
  4758.   global gWCpath
  4759.   global gWCvoicePath
  4760.   global gWCmainMusic, gpathAudio
  4761.   send mouseLeave to cd btn (the short name of me)
  4762.   play stop
  4763.   lock screen
  4764.   if gNAVcdev is "REMOTE" then
  4765.     hide cd bmp "Help_Remote"
  4766.   else
  4767.     hide cd bmp "Help_Touch"
  4768.   end if
  4769.   hide cd btn "Help_BackToMap"
  4770.   unlock screen
  4771.   enableNavBtn
  4772.   put "Help" into gWChilitedReg
  4773.   if gNAVcdev is "REMOTE" then
  4774.     put "Background" into gWCcd_or_bg
  4775.     send mouseDown to bg btn "Help"
  4776.   end if
  4777.   start cd timer "alarmSelect" of cd "National" expire in 2100 ticks
  4778.   --play file (gNAVEpcotPath & gWCpath & gWCvoicePath & gWCmainMusic) nowait
  4779.   set the soundFile of bg snd "main" to 
  4780.      (gPathAudio & gWCmainMusic)
  4781.   play bg snd "main"
  4782. end dismissPopup
  4783. -------------------------
  4784. on mouseDown
  4785.   global gWCacceptMouseClicks
  4786.   clearIdleAlarm
  4787.   if gWCacceptMouseClicks is not "false" then
  4788.     do "show cd bmp" && quote & (the short name of me) & "_hilite" & quote
  4789.   end if
  4790. end mouseDown
  4791. -------------------------
  4792. on mouseLeave
  4793.   do "hide cd bmp" && quote & (the short name of me) & "_hilite" & quote
  4794. end mouseLeave
  4795. downcity
  4796. leftbutton
  4797. leftcity
  4798. rightbutton
  4799.     rightcity
  4800. upcity
  4801. CINFO
  4802. AGM:Desktop Folder:POMO folder:Audio:TchUSmsc.aif
  4803. udio:TchUSmsc
  4804. mainTAIL
  4805. Zdata
  4806. ~~~~~~~
  4807. v``Q!"
  4808. <****
  4809. v``Q!"
  4810. 1111177
  4811. v``Q'$
  4812. vvxxvvv
  4813. vv``''$"
  4814. 0-08<
  4815. 117177
  4816. vvv~xv
  4817. ~~~~~
  4818. ~vxvv
  4819. pvvvvv
  4820. xxvvv
  4821. x~xvv~v~
  4822. v~vxx
  4823. xvxvv
  4824. vxvvv
  4825. ~~~~~~
  4826. 1!171717
  4827. vv``''11
  4828. 7(777(7'
  4829. vvvvv
  4830. 7717""
  4831. v```'11$
  4832. vvvvvvvv
  4833. vpvvvu
  4834. vvvvvvsv
  4835. vv`fpvvf``fv
  4836. >71'!!1771
  4837. ~~~~~~~
  4838. ~~~~~
  4839. 7!W``vvvvvvvvs
  4840. v`WW4"
  4841. !WWWv
  4842. --2--
  4843. ""'!`
  4844. vfRW4
  4845. "7!W``v
  4846. ""'/``p
  4847. xxxxx~~
  4848. "$'/`fpx
  4849. ~~~~~~
  4850. pvvvpvv
  4851. :(???
  4852. eGFH)
  4853. ??=8=
  4854. ==:?:
  4855. ?::?=:
  4856. ==8:?=8
  4857. y~if"
  4858. ??DF}F
  4859. 88:8=888=:8=8?=88
  4860. 8:??=8==8:::?=?===:8
  4861. :?:?===
  4862. ?=8:?===
  4863. ?:==?
  4864. ==???
  4865. ??????
  4866.     ppv`
  4867. p~cf&(:
  4868. =DFFD
  4869. :8:=88
  4870. 8=88==8=?::
  4871. ?=8:?8====:?===
  4872. ?:=:8?=
  4873. ???==
  4874. ?;?????
  4875. =8:88=:=8:8
  4876. 8:=8:?
  4877. 8:==8=::?
  4878. ?:=?88:=8?==
  4879. ?=8==
  4880. ::=?=:===
  4881. ?8==:=88
  4882. 8===:?8888?==:
  4883. :?888:
  4884. ???8=?8=88::?
  4885. ?=::=?=
  4886. ?==??8
  4887. ;;;;;?
  4888. ??????
  4889. 8888:=8??=
  4890. ?=?======:?:
  4891. :?:::8??
  4892. ???:???=??
  4893. ?==??
  4894. ???==
  4895.     ;;;;
  4896. 888:=8:==88=8
  4897. =8:?=
  4898. ?==:=8
  4899. ?8=?=
  4900. ?:=??
  4901. ?==?=??
  4902. ???=??
  4903. ??=??==?
  4904. ??===??
  4905. :==88
  4906. =8:==8:=8
  4907. 88?==88:8:==?:8::
  4908. =8?===?=:?
  4909. ????=??=
  4910. ?::??
  4911. ?8==?
  4912. =?=??
  4913. ?????
  4914. ~~~~~
  4915. ==88:=8
  4916. 8=8==8?::==?
  4917. :::?=8
  4918. ===?8?8:?
  4919. :?:?8
  4920. ?????????
  4921. :8::=888
  4922. 888=8
  4923. 888=8?::====8
  4924. =88:===??8?8:
  4925. ===8?=
  4926. :88=8
  4927. :?=8:8=88
  4928. 88::::
  4929. 88===888==??===8
  4930. :??=:
  4931. ??????
  4932. yyBU;;
  4933. 888:8
  4934. :?=:?=8:
  4935. ====:?
  4936. :=?=?=
  4937. ????=?
  4938. ????=
  4939. ???;????
  4940.                         
  4941. :=?==:?:?===8?
  4942. :==8?8:
  4943. y}}}}}}
  4944. ???=?
  4945. 888==
  4946. :88:8888
  4947. :?8===
  4948. :==8?8?=
  4949. ?====
  4950. 8888=8
  4951. 8=?:===
  4952. 8:?8====:=======
  4953. ~~~~~
  4954. NWWNWNWNNNWNNN{g
  4955. 88=88N|K~C~C~L====?=
  4956. CCTZZ#''''''
  4957. ////11/11/
  4958. '11/1111///
  4959. yQCYZQCCK
  4960. ?????
  4961. 88:888
  4962. ::8=8
  4963. xlj~l~CC
  4964. 88=8=::88=88=8=8
  4965. ??????
  4966. ==sF3
  4967. 88=8=:88
  4968.     <lZ3
  4969. ==_y*
  4970. {~~~{~{
  4971. !Z'/0
  4972. III-III-I-F-I
  4973. ===1{*
  4974. 8888=
  4975. 888888
  4976. ddddddddddd
  4977. ~~{{~~
  4978. 88888
  4979. :888888
  4980. Ydd~Y
  4981. 8:888
  4982. ==d'Y~Y~d
  4983. ,,((,,
  4984. 88888
  4985. =5?>?
  4986. fZ|d|Z|||
  4987. ~~~~~~
  4988. 18..8.8
  4989. 88888
  4990. g4c-8
  4991. {~~~{~{~
  4992. |>99>:=
  4993. oGKzWw
  4994. 2mR]N
  4995. Rgqq5
  4996. nUBB;
  4997. 626226(RyqR
  4998. ;??-"
  4999. vvvvv
  5000. uxmuxmux
  5001. vvsvsvvv
  5002. 8    48:
  5003. vvvvxvv~v~~{{~
  5004. {W0000E~
  5005. uEW500Mu
  5006. 85005005
  5007. xEW00W,}
  5008. 0000000g
  5009. vFW000*sa
  5010. s]W00WTv
  5011. ./>8807'
  5012. 000W:
  5013. ===d=d=
  5014. *999:
  5015. =d=~Y'
  5016. vvxx~x~
  5017. =Yd=~YYi
  5018. ~~{~~~
  5019. vvxvvv
  5020. LZLZ(
  5021. +r`Pb
  5022. ;?;?;;
  5023. :Ly|q0
  5024. JJnq.
  5025. :8::L8
  5026. vvxxv
  5027. ;;?;??
  5028. <<<<<&
  5029. <<<#<#
  5030. <<<#<#
  5031. <###8#'
  5032. ##<#<?<
  5033. `%<+@D\??
  5034. !!2!!''''''d
  5035. 2!++88!
  5036. +727.>fgU{
  5037. mtttt~s
  5038. ,-,&?
  5039. ;?;?;
  5040. Q!Wr]
  5041. :2~SKN
  5042. 47`UG
  5043. zyrzr
  5044. ???;;
  5045. !cbc^+3
  5046. <vDb3O?qD@%
  5047. Q,tWN
  5048. "rxeF
  5049. yyyyyq
  5050. yyyyyyyy
  5051. ?::=-
  5052. 77777
  5053. 6~;;1
  5054. 8HFii
  5055. <~;;1
  5056. 3?r,O
  5057. ,?s,P
  5058. |]<6-]<6
  5059. -]r--]r-
  5060. !JdsO$
  5061. !7LgR
  5062. -^,Maa
  5063. 2 rvN
  5064. |MLL(,
  5065. Loeo#
  5066. 3=M|\PYwom
  5067. <-_qR
  5068. X<6]A<6]|M
  5069. 4JdwP$
  5070. IT45)
  5071. LL[Uss
  5072. -P(Mao
  5073. x8!?Ul
  5074. &[MU7%3
  5075. +3MeW
  5076. AaL_"
  5077. ZaM^(
  5078. e<<=Mvr\(
  5079. 77?[Tc
  5080. +2-fS]C"J}|{2 2)222=+
  5081. 2LMeN
  5082. e<<3avJV
  5083. Jeee+
  5084. e]<6]]<6]
  5085. ]}k!a
  5086. k%<<]
  5087. AI]\    
  5088.     /(oT?:cX#
  5089. Fhs{F
  5090. ]Rs~W\C1
  5091. 0A\SsqV]
  5092. *88*4
  5093. "RWR~qSV\0
  5094. "C\W~s~WO
  5095. ]Ss~S]
  5096. V<66wl"66P
  5097. P]<<fk
  5098. k%6<]
  5099. >,-,,
  5100. (((,,
  5101. ((,,,
  5102. 1iiiii9?5
  5103. =T==5
  5104.         =/=
  5105. Ir]]la
  5106. !?!?!!
  5107. }}}}y
  5108. =5555
  5109. aaNaa
  5110. {{{{`{`
  5111. ??5???
  5112. %%%'8'88
  5113. }}}y}
  5114. Y?.--
  5115. 88888=
  5116. =:(*(
  5117. :88::
  5118. (*8::8
  5119. <<66!
  5120. w"6<jYaeD"
  5121. *((::*:
  5122. ::::::::*
  5123. *:(((:8*
  5124. (8(:::::8
  5125. X6V{{
  5126. RIMMMMI
  5127. ZTZZZT~
  5128. p_?]X;X
  5129. D"66k+LMT^)"1
  5130. .uu}-
  5131. wggggg
  5132. faaC!!
  5133. J''JdT
  5134.                 M/Ko"
  5135. e]<66k
  5136. 6666++..
  5137. bcWP#
  5138. 2("o0*
  5139. =4MFlr
  5140. wwvvv
  5141. =]<66k
  5142. w666X
  5143. wwwww
  5144.                     
  5145. ?4y4aj
  5146. ']<6.k
  5147. D666e
  5148. wgwwvg
  5149. ]<66k
  5150. k%6<J
  5151.                     
  5152. 4D??y
  5153. e<66D
  5154. k"6<O
  5155. wwwggwvggv
  5156. owwow
  5157.     M22Mr
  5158. D<66k
  5159. wwowwwwwg
  5160. <4M2y
  5161. O<66k
  5162. 27+(gc@
  5163. dlwww
  5164. wwwwwwww
  5165. vvvvvv
  5166. yDSI0
  5167. A<66w
  5168. D"66`
  5169. $,&&&3$$&
  5170. 5151515555
  5171. \lvlb
  5172. jSZS']66!k
  5173. udQ@5-
  5174. 1\brC
  5175.     oZVZ
  5176. 4444444
  5177. iWvlb
  5178. 44444?
  5179. p,-D@O
  5180. 1555555
  5181. 44444
  5182. 155155
  5183. 15555i
  5184. +\bp\
  5185. p\pK155
  5186. "555,
  5187. qqqq-->
  5188. ~g555j
  5189.                     
  5190.                     
  5191. 55555
  5192.                     
  5193. !9339
  5194. HvCb:
  5195. mSZV>]<66k
  5196.                                 
  5197. -QL}LSY    %
  5198.         1>q
  5199.                     
  5200. a}6]!
  5201. %wd$    
  5202. )))^))mC
  5203. ))))^))
  5204. w43P44p
  5205. ?3334P''
  5206. ;;;;;(
  5207. }}}}}}}}
  5208. }}}}}}}}
  5209. 11111
  5210. QLyLV
  5211. v\H\*
  5212. ]<66k
  5213. w66<U
  5214. vOI]*
  5215. >ZVEd    
  5216. }ZSH!
  5217. )QVCZZSiNIS3
  5218. ZZVC    
  5219. |CE\C0\Jm
  5220. r\9C>SKs
  5221. O\S\    
  5222. `NUC0IZO
  5223. CU*CFHc
  5224. oAH0FC
  5225. bqqpbb
  5226. ;;(.:-
  5227. #88        
  5228. 1181;1
  5229.     1>81    1
  5230. /$]AJa
  5231. :::::::
  5232. ::::<::
  5233. ::::<::
  5234. ::::::::
  5235. ::::::::
  5236. qy7yqU
  5237. 4:4:::::::
  5238. rErErC@E@K)
  5239. 55555
  5240. :::::
  5241. }!fWm
  5242. ]<66k
  5243. w66<w666    
  5244. f77=Q
  5245. Q777f
  5246. 16,/ii
  5247. RRRRNXRR
  5248. ::.lE\H0
  5249. D666/<66k
  5250. y777N
  5251. kw6<]S
  5252. :::4:
  5253. :::::
  5254. ::::::.@0
  5255. -AAAAAAr]r]r]r]]]-
  5256. kkkDD
  5257. rq-- 
  5258. :::::::::
  5259. ::::::::::
  5260. A<6666666]]]]]<66666
  5261. w}}}}}NaNaNaNaaal
  5262. wIIIf
  5263. }}}}}
  5264. 4::::4
  5265. :::::
  5266. P]P]AAAAr]r]r]r]]]]]]]<666666
  5267. aaaaa
  5268. ::4:::
  5269. :::::4<
  5270. ::::<::
  5271. ::::::
  5272. -]lalkw}}}NaNaNaNaaaaaaa
  5273. Uy7sUU
  5274. 4:4::
  5275. 4::4::4
  5276. ::::4
  5277. ::::::
  5278. :::::::
  5279. :::::
  5280. ::96:
  5281. rr-% 
  5282. ::::::
  5283. :::XT
  5284. k/]r/
  5285. :::::<
  5286. ::4::
  5287. ::::::
  5288. :::4:
  5289. =======C
  5290. DU9N]+w
  5291. :::::
  5292. ::::<
  5293. Pusv/
  5294. qy7yy
  5295. :::::
  5296. :4:4:
  5297. ::::>
  5298. :::4:::
  5299. :4:4::::
  5300. :::::::
  5301. :<:44
  5302. Vxm.;
  5303. w}}}i
  5304.  {ffF
  5305. ]<6!k
  5306. k"66]I<66k
  5307. w666w666
  5308. 6wkD<wa3<6<A
  5309. B\fN4
  5310. \f\HHf\.Y
  5311. ::4:44
  5312. ANf$faR
  5313. :::::4
  5314. ::::4
  5315. ::<:::
  5316. qF>ZCL\fr4:
  5317. @-CFNV
  5318. 4rr>>SC
  5319.                         
  5320. ::4:::
  5321. :444:
  5322. <: b<4
  5323. :4:::5X#
  5324.                     
  5325. ~v~J:
  5326. :4:4:
  5327.                         
  5328. 24555
  5329. sz}}vv
  5330. ::4::<:
  5331. ;;;;;
  5332. nyyyy
  5333. >V4::
  5334. ::4::
  5335. Uy=sUU
  5336. x`EV:44
  5337. 1555,
  5338. 4:::::::
  5339. ==55=
  5340. 211155
  5341. sz}}v
  5342. %BBwi
  5343. k"66]"666
  5344. w666w666
  5345. f"6<P
  5346. :44::
  5347. :44:4
  5348. uuuuuuuuuuuu
  5349. uuuuu
  5350. :86:04:
  5351. 2BB[X 4
  5352. :<4::
  5353. :4::::4
  5354. uuuus
  5355. uuuuu
  5356. kwDkDI
  5357. pss}s}
  5358. ::4::
  5359. uuuuuu
  5360. 5=5=,
  5361. K~Z***
  5362. kJArIr
  5363. 24555
  5364. ~~u;;
  5365. ====5
  5366. 5Kg@~g5
  5367. K~\p~
  5368. 54515
  5369. Rp)\pig\
  5370. 2$+/XFBBXR
  5371. ~~~~~0
  5372. kfI-rNU
  5373. uE^E?
  5374. (~g~Pk
  5375. 2 /+pbii
  5376. bBBX$+Bw_
  5377. ~X==C
  5378. P<6%f
  5379. w666w666
  5380. " /XBFBpbii
  5381. bBX+6s
  5382. ~~~~~
  5383. :+BFBdbi
  5384. ~~~~~
  5385. 7451/
  5386. bm"-S
  5387. ,pg@rKs
  5388. gGrkg
  5389. p)P"d~~~\
  5390. ~gss5
  5391. 55~~~~~~~~~~~~~
  5392. 5~HO@Kg
  5393. ~~~~~~~~~~~p
  5394. 5,~~~~~~~~~~~
  5395. Wip"X)"p~~~~~~
  5396. ~~~~~~~~~~~~~~d"piKK,~~~~
  5397. ^)))^))-?
  5398. )))^))mC
  5399. ~~~~~~~
  5400. ~~~~~~~
  5401. ~~~~~~~"\
  5402. 434P4'
  5403. w43P44p
  5404. 1,i~X
  5405. ~~~~~~~~
  5406. ~~~~~~~~~~~~~~~~~~
  5407. ~~~~~~~~~~~~~~~~~~~
  5408. ~~~~~~~~~~~~~~
  5409. ~~~~~~
  5410. ~~~~~~
  5411. ~~~p~
  5412. ~~~~~~~~~~~~p~~~~~~~~~~~~~
  5413. 24515
  5414. ss}xv
  5415. uuuuuu
  5416. ''%%'''%%%
  5417. ~~~~~p~~
  5418. ~~~~~p
  5419. ~~~p~~~~~
  5420. ~~~~~~~
  5421. ~~~p~
  5422. ;uuuuuuuuuuuu
  5423. '.%,%.'
  5424. ~~~~~~~~~~~~
  5425. ~~~~~~~~~
  5426. ~~~~~~
  5427. uuusus
  5428. suusuu
  5429. .'..,
  5430. ~~~~~~~~q
  5431. 04215
  5432. 6Cl>>f
  5433. Vq\>>f
  5434. VqO-HXhp+
  5435. 0Mh>>Hh
  5436. uuusu
  5437. p~p~~p~~
  5438. 74115
  5439. &-qSO
  5440. ~pp~~
  5441. p~~~~~~~~
  5442. 74515
  5443.     '    =    
  5444.     6(#Zlr}
  5445. te{yylr
  5446. r`&Y%?
  5447. S]]TK
  5448. ~~~q~
  5449. ~~~~~h
  5450. w666}666
  5451. k"6</(66D
  5452. 6666A<66w
  5453. k%66]
  5454. \pss}
  5455.     =.%    
  5456. >436rfhh
  5457. vrlvv
  5458. r__W3
  5459. w66<w666
  5460. D"6</(66k
  5461. k%66]C<66fa!66]
  5462. .%'''
  5463. XcZ227?.
  5464. +.+2&||X
  5465. ~~~~~p~~
  5466. ~phf+!
  5467. .;;;;
  5468. %            =
  5469. -(#Zlrp
  5470. _]FFj
  5471. gidpp
  5472. q)hUUe+
  5473. h)b++
  5474. ]<6!k
  5475. w66<w666
  5476. w666}666
  5477. 6<<>-6A
  5478.                         
  5479. AAAAAAA
  5480. _bbb=
  5481. 48&Zma
  5482. ]]]FKifi"~
  5483. gCa*=Ar]J}Naa
  5484. kkk}]]]A
  5485. ]<<!k
  5486. w66<w666
  5487. k.6<]Y
  5488.     tnSU
  5489. %        '    
  5490. ~ppp"K
  5491. -]+}Naa
  5492. aaaw]P
  5493. w_%Wrv
  5494. ggggK
  5495. AAA]r]r]]<6
  5496. N]<66!}}}aNaNaa
  5497. 3F<66k
  5498. D"6</(66k
  5499. 51//m
  5500. d.(0,
  5501. ?%%Qnttt
  5502.     &7&,
  5503. 468:6
  5504. D]^]S]fD
  5505. 4<:+:
  5506. qibbr]]]DDJ4:
  5507. ;;(;;;
  5508. iii1*
  5509. _SK@@GK
  5510. {y7yq
  5511. Dk!<-
  5512. rtqqY
  5513. A^!"-)'P"
  5514. pgWKKKg
  5515. fy7yf
  5516. kkkkkkkaa
  5517. AakkkkkkkkkDkDkDkDkDkDkDkD]!
  5518. uuuuu
  5519. r<6<]IIIIIII]
  5520. NNIIIIIIIIfIfIfIfIfIfIf]r
  5521. 6ONTb
  5522. ~gZM=+V
  5523. N=77y
  5524. q77=F
  5525. P<66l
  5526. f"<<P
  5527. 3  %bw
  5528. M~Kw4
  5529. uuuuu
  5530. uusuuuuuu
  5531. q@I@q
  5532. %%Qbq
  5533. \^E^~
  5534. bDDD#
  5535. Cm~^=
  5536. fXLC+
  5537. k777\
  5538. k666pAAAp3
  5539. 7>1/m
  5540. d..06
  5541. ttttn
  5542. E^E$a
  5543. s`U^~mXSUm~~+
  5544. MC+<<<<+ls=s3y7yU
  5545. y777N
  5546. N=77y
  5547. k!66]
  5548. nqzq=
  5549. zwvH_PaH
  5550. Z_ZDDA
  5551. "DADcgIg
  5552. M=++]<66k
  5553. q777F
  5554. b777U
  5555. D666/<66k
  5556. k.66]
  5557. 71(,m
  5558. d>06*
  5559. im~M=K
  5560. ;iKHX]/ulZHfwe
  5561. gbMM+!
  5562. ]66!k
  5563. y7sDy7yU
  5564. k666p<66
  5565. 71(/mb{h
  5566. 6(-#lrpt
  5567. qQW- 
  5568. C\_ffffffgf_
  5569. "7"2" #7
  5570. {{ttvyv
  5571. <044+6
  5572. sssss`ss
  5573. fy=sUalI
  5574. 6::86
  5575. EEEEtj
  5576. cA_R 
  5577. mCMC6
  5578. k666/<66D
  5579. k%6<]
  5580. 0fo\G
  5581. 4:6<<<
  5582. ytyh,
  5583. fDC]_"
  5584. Qv}v|xG
  5585. <40<<<
  5586. EEQ11
  5587. ::::6:666-
  5588. EE\11
  5589. sssss
  5590. kkkkkkkk
  5591. v:4::
  5592. ylryr
  5593. EE\11
  5594. lkkkkkkDkDkDkDk
  5595. kkkkkkkDkDkDkfwwww
  5596. 666666]]IIII]
  5597. tttggqss
  5598. Y}wwwwkDkDkDkDkDkDkDkDkDkDkkkkkkkkkkkkkkkkkkkkk
  5599. A]IIIIIfIfIfIfN<]]IIIIIfIfIf]PAAAA-
  5600. 1EEEtg
  5601. ssssss
  5602. mULL!
  5603. A]<6wk
  5604. /aDkk
  5605. D"66r
  5606. A<66w
  5607. 66<6+
  5608. 3+h\30Cu
  5609. ~vfv.
  5610. yy+yww
  5611. >=8~VCg272
  5612. I"%.k
  5613. VAA]e
  5614. `]rE|66.k
  5615.  D666`.*2"
  5616. %z)oR
  5617. +=+sXCX&?2?
  5618. ]<<!k
  5619. 666}<<<}
  5620. }<<<A]<66k
  5621. k"6<]
  5622. 3+moD'CFw
  5623. +="sUC\
  5624. s+27A
  5625. ]]<!kk
  5626. lAAA-
  5627. r<66D
  5628. w"66AI<66k
  5629. **!_rr!CXn
  5630. \OEOUEOE
  5631. &-~rXV
  5632. +4??X<66w
  5633. N]]pN<6
  5634. 666w666w
  5635. w666w666
  5636. k%66]
  5637. EEE1EOE;
  5638. ssss)-~~WV
  5639. 666w<66w
  5640. w66<w666
  5641. k66<p<<6
  5642. *HHHT
  5643. 111LEL
  5644. DIfI"6r
  5645.                     
  5646. EEEEE
  5647. <&.,.
  5648. D!66666666
  5649.                             
  5650. +f66666
  5651. NaDI!
  5652. Xssss`X`
  5653. --7--
  5654. LggbgqLq
  5655. (]vv[M[d](
  5656. ovMvo)\wvn
  5657. neHfn1yyyg
  5658. Is`gg
  5659. 07777<5
  5660. ",)21.
  5661. OO}1OE}1
  5662. kkl6]]P
  5663. ]<6!k
  5664. kaf<A
  5665. kDkDkDI
  5666. kIADl
  5667. <IfIfIr
  5668. 663%%
  5669. 81115
  5670. ;1111.
  5671. ;;;;;
  5672. %%''85*58
  5673. a00g;
  5674.                         
  5675. ;;;;;;;
  5676. ttv{vv
  5677. ;;;;;;
  5678. ;;;;;;
  5679. ~``"1.
  5680. ;;;;;;
  5681. ;;;;;;
  5682. ;;;;;;
  5683. ~s``+1
  5684. ;;;;;
  5685. ;;;;;;;;
  5686. ;;;;;;;
  5687.                     
  5688.     =.,,
  5689. 00072
  5690. ;;;;(222*;;;;;;;;
  5691. ;;;;;
  5692.                             
  5693. ;;;x222
  5694. ;;;;;;;;;;;;;;
  5695. -P]<}aD
  5696. ;;;;;;;;;;;;;;
  5697.                         
  5698. ^)))^))3
  5699. F1ED}
  5700. 6<<p<66k
  5701. kD66]r
  5702. 5\_o}
  5703. 21;;;;;;;;;;;;
  5704. ;;;;;;;
  5705. sxc@h
  5706. ;;;;;;;;;;;;
  5707. ;;;;;
  5708. ;;;;;;;;
  5709.                             
  5710. A]]<}aak
  5711. kfI]'
  5712. v{v{yy
  5713. ;;;;;;
  5714. ;;;;;;;;;;;
  5715. ;;;;;;;;;;;
  5716. N']6}aa
  5717. ;;;;;;*
  5718. ;;;;;;;;;;;
  5719. ;;;;;;;;;;;
  5720. kD<N'
  5721. ;;;;;;
  5722. ;;;;;;;;
  5723. ;;;;;;;;;;;;
  5724. ;;8;;
  5725. 8;8;1
  5726. Ot}ttO}t;;
  5727. ;;;;;;;;
  5728. 8LOL1ZZZ
  5729. k<66D
  5730. kw66]
  5731. N=77y
  5732. kw"6]A
  5733. (-3/27
  5734. ;;;;;;
  5735. 02g;;
  5736. ;;;;;
  5737. ;;;;;
  5738. ;;;;;;;;;;;;;;;;;;;;;
  5739.                     
  5740. 1."1"
  5741. 0(;;;;;;;;
  5742. ;;;;;
  5743. ;;;;;;;;;;;;;;;;;;;;;;;
  5744. ;8;;;;;
  5745. kkf6]N!
  5746. ;;;;;;;;;;;;;;;
  5747. ;;;;;;;
  5748. ;;;8;8;
  5749.                         
  5750. N.4%66]]P
  5751. ;;;;;;;;;;;
  5752.                         
  5753. fy7yqU
  5754. 8        8    8
  5755. ;;8;;;;
  5756.                             
  5757. ((731
  5758. 201;;
  5759. ;;;;;
  5760.                                     
  5761.                     
  5762. ~~~4!
  5763. !!!!!568
  5764. u~~~~u
  5765. 8;88    
  5766.                     
  5767.         8    88;
  5768.                         
  5769. `u~u4!
  5770. ;;;;;
  5771. ..(;1
  5772. ;;;;;
  5773. 8;888888    81
  5774.                         
  5775.                     
  5776. afEAA]<6
  5777. ;;;;;;
  5778. 88;8;81
  5779.                                     
  5780. 0D;;;;
  5781. ;88;8888
  5782.                                                                     
  5783. ytvlv
  5784. ;;;;;;
  5785. 8;8;;8
  5786. 8;888;
  5787. ;8;88;8;
  5788.                                                         
  5789. }{            
  5790. nvy{p
  5791. rlrry
  5792. ;8;;88;
  5793.                                         
  5794.         y        
  5795. nlyyvl{
  5796. yyrrr
  5797. 8888;
  5798.         8                    
  5799.                                 
  5800. vtttt
  5801. FFtqF}Oq;;;;;
  5802. D~D*;
  5803. ??X<66w
  5804. y77.N
  5805. %6<]R<66w
  5806. k666]
  5807. `."11
  5808. ;888;8;
  5809. ;;122
  5810. 8;88;
  5811. <001=
  5812. 14336
  5813. ;;;;;;
  5814. 63633
  5815.     8            
  5816. vvvtl
  5817. ;;;;8;;8;
  5818. 63364336
  5819. 8    8                
  5820. fIIII<fD(N'
  5821. tntnvv
  5822.             yl
  5823. 33333
  5824. 6334664
  5825. 36366
  5826. DunDDD*
  5827. AAAp3
  5828. PW66fa
  5829. k66<J
  5830. gOZN7
  5831. nlntnvtt
  5832. 888"ln
  5833. ttvyn
  5834. 66666((2
  5835.                 1
  5836. ''%..
  5837. w666X!
  5838. `ggS0
  5839. 2..ss
  5840. _-%777
  5841. 31316
  5842. 63633
  5843. -AAAl
  5844. P]<6fk
  5845. 846333
  5846. 3643363
  5847. tED~t.
  5848. ]<<6k
  5849. k666]
  5850.     6666
  5851. -77?7
  5852. 3738;
  5853. ;8030
  5854. 3163663
  5855. mtDDm;
  5856. 18EI@.Z__
  5857. D<66f
  5858. w66<A
  5859. `gtS/
  5860. 2.4-+06+
  5861. -h'%(=
  5862. 33;73
  5863. 1636663
  5864. 8;;;8;
  5865. QL@INZ__
  5866. C|kb<
  5867. *$.Pkam
  5868. O<66k
  5869. Ok"66]
  5870. 61633
  5871. 8;8;8;8;
  5872. Sk<5.
  5873. ?$%Pam`
  5874. 66666
  5875. 66666
  5876. k"66]
  5877. 3>61<
  5878. lllrrrrrp
  5879. 333?3
  5880. 63166
  5881. 1            1
  5882. 8818888;
  5883. 1            1
  5884. 8686868
  5885. 1?3313
  5886. =5=%#
  5887. ?$.P~ma
  5888. r<66D
  5889. k%66]
  5890. fOUP7
  5891. =<11<
  5892. QEZEN
  5893. 88    OZ
  5894. ?$$.~~~m
  5895. 826822<2
  5896. P<66f
  5897. gfSP#"
  5898. ;68806
  5899. 3>>663>
  5900. 383368
  5901. `-X28
  5902. >22-2222
  5903. +!+?]66"k
  5904. ,\XGc]
  5905. =<700
  5906. ;8830
  5907. =====
  5908. ~uuuuu
  5909. u~u~u
  5910. =11<<30
  5911. 888282:
  5912. -a888
  5913. <<<<=
  5914.         =kss
  5915. 00gg`
  5916. s`ssssss
  5917. sssss
  5918. 00000
  5919. tyttr
  5920. 8FdrP$
  5921. ;ttDPtt$
  5922. 8tqtL
  5923. Attm5
  5924. OttdOtt
  5925. taOtm~d+24
  5926. y777N
  5927. fclT$;(
  5928. 8*<<8
  5929.                     
  5930. ;;;;;
  5931. ;;;;;;;;;;;
  5932. .8>>>8>>
  5933.                         
  5934. ;;;;;;;
  5935. 8>88>8
  5936. '8wgOZ;
  5937. @@@_qO
  5938. C]DSX_D
  5939. x2+4L
  5940. zs7s0\
  5941. !mgic*;-
  5942. 131113
  5943. czfT;>-
  5944. twwdq 
  5945. 11111
  5946. RR8jc
  5947. -u'8wxOZ
  5948. Fjg?!
  5949. c~mT$;(
  5950. ;3(_llr
  5951. rrhh-
  5952.                         
  5953. _UC_U_I
  5954. +.=|oaYM
  5955. 273+$Tf@uGCDK
  5956. rv|``~~d
  5957. g`zy`hdi
  5958. <>5(%(
  5959. ,- 3 666
  5960. 60682
  5961. 66:26
  5962. RDRRR
  5963. 1<1=<
  5964. >333<<
  5965. <111?
  5966. g^^^^
  5967. ~DD[[
  5968. -$$Tf~
  5969. jhT$/-
  5970. ttt{t
  5971. 7??;6>>
  5972. 01><<
  5973. *~l~l
  5974. rr    qF~^
  5975. pDD[*--$$ff~~
  5976. ~fc$;-
  5977. v`\Z"
  5978. <8080
  5979. 9VdUo1
  5980. Ug+*@2)]F~U
  5981. ppfc$;-
  5982. vl^"*8
  5983. "*^drr
  5984. ~vlh&
  5985. ,~l~~
  5986. 6%&F@X
  5987. -%$$f
  5988. "*sbqr
  5989. ~k^Q7
  5990. 33:66
  5991. \...)..).).).3
  5992. 11*11
  5993. 1<><1
  5994. 333>33
  5995. g^9SSS4>2]]co
  5996. ^^^^>3@SUR'Ska9^g
  5997. +dldl
  5998. bV=N]k
  5999. 1>3@bST@S39^^9
  6000. 9999^^
  6001. `83f~
  6002. SO_3S39^g 99
  6003. goyy'
  6004. B))0k
  6005. g7g99
  6006. R8j8jq
  6007. @i8uR
  6008. gKJsg
  6009. osy_9
  6010. )grJs
  6011. OsJ@(
  6012. ?rr@?
  6013. S}"|mC
  6014. ;t"rrJ
  6015. s^1"'s
  6016. (8mUU^g
  6017. :228:
  6018. _YXY^^
  6019. N+U~|M8>O^
  6020. f''1^^^
  6021. A$2==
  6022. =QSxg
  6023. y''>^
  6024. 9{~b(
  6025. XNA|$2=
  6026. A$$2=
  6027. vvwvv
  6028. ;~jV?
  6029. ^1"-72
  6030. 88888
  6031. Y^^Y^
  6032. ^1y&78
  6033. ^^^^^^
  6034. 18``s
  6035. YX^Y_
  6036. h`1^^(78
  6037. ^o1$7
  6038. XXYXXY
  6039. GG<<<G
  6040. 58>`sx
  6041. XXYX^
  6042. XXXXX
  6043. rqrt::
  6044. YXYXYXYX=
  6045. YXYXYXYY
  6046. YYYYYYYYY
  6047. {S*SS>$
  6048. dddQy
  6049. {dSdQc
  6050. XXXXX
  6051. SSSSSSSSS
  6052. SSSSSSSSS
  6053. ^^^^^
  6054. IHIHIHIH
  6055. IHIHIHII
  6056. IIIIIIIIIY
  6057. yErE(9N
  6058. XXXXX
  6059. 58+`s
  6060. $Uvj&22:0
  6061. XXXXX
  6062. {~stLuZA&
  6063. ImII-==
  6064. -IFdY
  6065. XXXXX
  6066. (c>c>
  6067. s(c>c>
  6068. )""-.
  6069. vvvvv
  6070. 51181    
  6071. 11115
  6072. dd=d===
  6073. {A99=
  6074. )..).
  6075. ;qhed
  6076.     XXXX
  6077. 5*)_..
  6078. Id@YY==
  6079. S\)WW&
  6080. SAf!%
  6081. E'!!N
  6082. *dd!*d{{{{(G
  6083. {S}Z<
  6084. {d{E!{{ZZ{{
  6085. {d{!!*{Z
  6086. {{!!d{!!
  6087. 55,$pB
  6088. -=>=0=>0
  6089. 3[6XX
  6090. {{{{oX
  6091. /227$"+
  6092. dd=dd==
  6093. ddS#2
  6094. X*Sd{
  6095. ;;ddd
  6096. .)__)
  6097. #9|A|#
  6098. NNQ#9
  6099. (XZ'yE
  6100. T@hyBZKl
  6101. $$K$Z$Klslsrp
  6102. ##9#99
  6103. '9##927X
  6104. P(SSS
  6105. ))&))
  6106. oggggO^U
  6107. o9oVV9V
  6108. IHmI7II7
  6109. ImI7II==
  6110. XXXXX
  6111. GQyQG
  6112. =YX@d
  6113. YYd@d
  6114. XoXXX
  6115. ========
  6116. ========
  6117. ===:^^^^==
  6118. ?=de^
  6119. ^^^Y^X
  6120. 5))&Z__
  6121. YXXYXXYX
  6122. qg!&<
  6123. ''5'''5;
  6124. ?<<:    
  6125. <kmrA
  6126.     33-3wlr~
  6127. 2A<2vtyv
  6128. ;?]IIl
  6129. 8`kk_
  6130. nrnh?
  6131. Psuu%
  6132. i`~f            
  6133. gjjjV
  6134. DDCWy
  6135. %((--
  6136. tll~}wld
  6137. penR4
  6138. irIW ;
  6139.     ii`ikrzi
  6140. &___yD
  6141. qq`s(>->
  6142. "3_}q`
  6143. ly]];
  6144. 66::                
  6145. !(!(    
  6146. iir] 
  6147. ??;)"
  6148. ffl>%
  6149. ;&__dy
  6150. ys:A=Z
  6151. sbMM>-
  6152. 3Ug``
  6153. 5%%!c
  6154. ;)d[d`
  6155. 144    4;4
  6156. 6R^S~
  6157. ~{s^^
  6158. w|rryrr
  6159. Sree/
  6160. =;/!gz
  6161. `.[$1
  6162. rZ#T&
  6163. 6!-^sss
  6164. ssuss
  6165. 3U^~~
  6166. xV@F8
  6167. 8%[%u
  6168. 8[%xx~v
  6169. su~vu
  6170. :63>    :    
  6171. -tww}tlw
  6172. 4==4=
  6173. }SqS}S}S}SSSSSISSS_U_SSkSSESqSSkSSqSqkkkkqk
  6174. ---^```s`sm`s\m^`\`^mXXQQQQYXQX``````````
  6175. `ssss`sss~s~s~s~sssrs~
  6176. ~~r^`^
  6177. ^`^`s``s-
  6178. -X+""1
  6179. --`s~~
  6180. s``-+1
  6181. w}w}}}w}
  6182. ''88.%'
  6183. 862&b
  6184. ;;??&fYf{
  6185. 1;4=4=4=4=4=
  6186. UFFZm
  6187. jgna&.
  6188.     1    188
  6189. /@TPl
  6190. rg&&&?
  6191. iiwwi
  6192. =4=    =4=
  6193. 8;.;8
  6194. xlhen\*&43
  6195. 2%wlglglleWF
  6196. 55555
  6197. 5555555555.
  6198. 5555>55
  6199. }iiw}i
  6200. 86]FFP
  6201.     4=4=
  6202. 4==4    =
  6203. iV',?
  6204. qqxuqq
  6205. 0---*---*
  6206. (ZW}g
  6207. vW--v
  6208. v*vvE
  6209. $4?:63?+
  6210. #3933
  6211. .0.'    
  6212. 0VSHI0
  6213. ;-r|xl14===4=
  6214. 4    ==    4
  6215. =4=    =4/
  6216. (Z\\g
  6217. +'3<:?+"
  6218. DD99}
  6219. 6#]]~Z1
  6220. Yw~C%    =
  6221. 4==    ;1
  6222. :::<:
  6223. '22ZS}}
  6224. nVF*nzF
  6225. nk*V8?
  6226. <#]UtZ
  6227. `e^X1=
  6228. ==44    4    444
  6229. :>::::::::::
  6230. ::<4    
  6231. 623:22
  6232. (HBDj
  6233. ayrlaZ
  6234. rhhZ,
  6235. 68:%    
  6236. <6T^eb
  6237. ;??;;?fq
  6238. q~wqi
  6239. ,U~`Xhkcvl
  6240. 6684=
  6241. <8668%    
  6242. ,,%%=
  6243.     =44                4=
  6244. 6262:62
  6245. nllrn
  6246.     4    ==4=
  6247. 4==4==4
  6248. }u}suuuu
  6249. 22:266666(866(626
  6250. %%%%.%.
  6251.     =4    4    4=
  6252.             4    ==
  6253. :9::::
  6254. {trrr
  6255. ((XZ#(!
  6256. =1    4    =
  6257.     =    4        
  6258. yrvyvv
  6259. tyt{y
  6260. }tr(Z(
  6261. WT-Z&(
  6262. %%%%%%%'
  6263. }wuw}
  6264. =44==444/
  6265. hhlhr
  6266. <6242
  6267. rll((
  6268. h(6#v"
  6269. (n(22
  6270. =%%88'
  6271. lwwwuwwu
  6272. =    4    1
  6273. 22666222
  6274. $$uwuwwi
  6275. 66lvt
  6276. 114;%
  6277. 86:46:46
  6278. rvvnnnvlX
  6279. 666666
  6280. 8==.%
  6281. 6222(72
  6282. 22((r
  6283. lnrlllv
  6284. &FFDD
  6285. fldw}
  6286. =rllh(66
  6287. rlllva
  6288. aa^Z66
  6289. 4%66666422
  6290. 6ng[g
  6291. RXZ,688
  6292. 6ZdZ6,6(PPXZ
  6293. 6(llnrlr
  6294. :::6::::
  6295. @:>4 
  6296. rrll(>
  6297. 6V@@v
  6298. 6:2362
  6299. ?6dnn
  6300. 2(((hr
  6301. =''%'
  6302. vrvlh#
  6303. >::3    
  6304. 66:(86
  6305. 2226(2
  6306. ::    ybhZdl#((
  6307. >>>>>>>%%
  6308. j#(-46(((666
  6309. 666226
  6310. tvrh6(22
  6311. %%    %    
  6312. %',=.
  6313.     8.'.8
  6314. ",6^zzv
  6315. ~vbZ6(62
  6316. 6ZO@v
  6317. fhrh22
  6318. ======
  6319. :9:::
  6320. 22222
  6321. =====
  6322. %,,==
  6323. ryryr
  6324. rl626
  6325. lyrll6
  6326. rrr(((lhlhhl
  6327.     <>7&=
  6328. =====
  6329. ,'%''
  6330. rlrllr
  6331. rrrpy
  6332. 84:66,l,66bhb`u
  6333. 222626
  6334. rrprh
  6335. 5====
  6336. =.=.,
  6337. rrlrrh
  6338. rhhllh
  6339. =%,%,
  6340. %    %    %=
  6341. ,lrhh
  6342. rrrrlr
  6343. .'.,.
  6344. rrlhx
  6345. 8data
  6346. 5TAIL
  6347. )data
  6348. UASAUUUUUASUUOAUUAAUUUASAASAUUUUUUAAUUAUAGAUUUUUUSAAUASUUGUAUGAGAAGASAUGU@OAAGAGASAG@SAAAGU@UAUGAS@@GG@AA
  6349. UUUGUAUUUUUUUUUU@UAGAGSUASAAGUSUAAUSAUSAUGSASAASUOAGUGUUUAUGASGAUAUSAUAUUAGU@OASGAUAAGUUAGAGGSAGGASA@U@S@
  6350. XXUOAAUOUUAUAASUUUAUUUAASAGUOAGSASAGAAUAAGAAUGAGAAGASAGAAGAUAAGUAAGSAAAG@AG@AAUAU@AAGAG@AG@A@@AG@@@@@AGAG
  6351. iXUAUUAUOUUOUUAUUOGAGASAUUAAAAAAUAGOAAAAGO@AAAGAUAUSAAAUAAAUAGOAGAAGAAA@AGAAAGAG@GAGAA@AGA@AGAU@G@@@AG@@A
  6352. tkXUUAUAGAUAAAUAAAUAASAUAAUUUUASAGOUUUAUAUAAUAASOAGAUAUAASAGUAUOAAUAUAGAG@SSAGOAGASAUG@AAG@GAAU@@@G@@@GOA
  6353. kXUOUOUUGSGUAAAUSAGUAUAAAOOUOUOUUUUUKXXUUUUUUUUUUOUUUUUUUUUAUUXUUAUUUOUUUAUUUAUUAUUUUAUUUAUAUUUUUUAUUAASASUAUAAUAAAUAAGA@A
  6354. ====^
  6355. XYXY^^
  6356. 1XXXXUA@
  6357. XYXYXX^YXY
  6358. kkXU>*
  6359. Y^^^^^Y_Y^^
  6360. Y^^^^^^
  6361. XY_Y_
  6362. I-d===
  6363. P:1$$$
  6364. Y---d
  6365. 444Auuu
  6366. aWW]:
  6367. uupW>W$
  6368. _YYXY
  6369. \p[)p)p)[\\\:)\606:<<<<06:\:\\:\\:\\:\::6:\:\0:6:6:06:6:
  6370. u~duu
  6371. +;&Z|pO:
  6372. Q[e#12
  6373. !-3=]]]]s|||||s|]|||||||||
  6374. |]]s|
  6375. s||||
  6376. zs__93###
  6377.  #$"  $
  6378. -333333FFFFF3FF3FFFFFWWFWWF9FWWWWFWWFWWWWWWbbbbbbs|
  6379. ||zzsszsWFFFWFWbzzz|bszz||
  6380. z_d_B9&#
  6381.    #"  $.
  6382. ('('---(((-('('---3933933-399933333-393999999DDD_x
  6383. xg__MFDDDD9339999DD_DD99D__d___ggxxgxxxd_MMB;0###    
  6384.   ).1
  6385. "_vtr
  6386.     r{jr
  6387. #"((#
  6388. &(((&&&00JJMJ;;000&((0&(&&0(0&000000;;;020000;;;;JJJJ8;888.)&$&$.11115<<
  6389. >9??9
  6390. :99:9:
  6391. "TAIL
  6392. +data
  6393. UASAUUUUUASUUOAUUAAUUUASAASAUUUUUUAAUUAUAGAUUUUUUSAAUASUUGUAUGAGAAGASAUGU@OAAGAGASGAGSAAAGU@UAUGA
  6394. UUUGUAUUUUUUUUUU@UAGAGSUASAAGUSUAAUSAUSAUGSASAASUOAGUGUUUAUGASGAUAUSAUAUUAGU@OASGAUGAGUUAGAGGSAGG
  6395. XXUOAAUOUUAUAASUUUAUUUAASAGUOAGSASAGAAUAAGAAUGAGAAGASAGAAGAUAAGUAAGSAAAG@AG@AAUAU@AGAAG@AG@A@@AG@
  6396. iXUAUUAUOUUOUUAUUOGAGASAUUAAAAAAUAGOAAAAGO@AAAGAUAUSAAAUAAAUAGOAGAAGAAA@AGAAAGAG@GAAGA@AGA@AGAU@G
  6397. tkXUUAUAGAUAAAUAAAUAASAUAAUUUUASAGOUUUAUAUAAUAASOAGAUAUAASAGUAUOAAUAUAGAG@SSAGOAGASAUG@AAG@GAAU@@
  6398. kXUOUOUUGSGUAAAUSAGUAUAAAOOUOUOUUUUUKXXUUUUUUUUUUOUUUUUUUUUAUUXUUAUUUOUUUAUUUAUUAUUUUAUUUAUAUUUUUUAUUAASASUAUAAUAAAUAAGA@A@
  6399. XYXY^^
  6400. XYXYXX^YXY
  6401. kkXU>*
  6402. Y^^^^^Y_Y^^
  6403. Y^^^^^^
  6404. XY_Y_
  6405. kKA@@A
  6406. @A@A@@@A@A@AX
  6407. ^^^XYYXY
  6408. ^^^YXXYX
  6409. Y^^YXXYX
  6410. Y^Y^^^^^
  6411. a8?52,y
  6412. XXYXYXY
  6413. XYX^XYXXY
  6414. uupW>W$
  6415. _YYXY
  6416. \p[)p)p[\\)\\\6:606:<<<06:\:\\:\\:\\:\::6:\:\0:6:6:06:60:
  6417. uuuujf
  6418. +;&Z|pO:
  6419. Q[e#12
  6420. !(-=F]]]]s|||||s|]|||||||||
  6421. |]]s|
  6422. s||||
  6423. zs__93###
  6424.  #$"  $
  6425. --33333FFFFF3FF3FFFFFWWFWWF9FWWWWFWWFWWWWWWbbbbbbs|
  6426. ||zzsszsWFFFWFWbzzz|bszz||
  6427. z_d_B9&#
  6428.    #"  $.
  6429. ('('---(((-('('---3933933-399933333-393999999DDD_x
  6430. xg__MFDDDD9339999DD_DD99D__d___ggxxgxxxg_MMB;0###    
  6431.   ).1
  6432. "_vtr
  6433.     r{jr
  6434. #"((#
  6435. &(((&&&00JJMJ;;000&((0&(&&0(0&000000;;;020000;;;;JJJJ;8888.)&$&$.11115<<
  6436. >9??9
  6437. -data
  6438. UAUUUUUASUUOAUUAAUUUASAASAUUUUUUAAUUAUAGAUUUUUUSAAUASUUGUAUGAGAAGASAUGU@OAAGAGASGAGSAAAGU@UAUGAS@@GG@AA
  6439. UGUAUUUUUUUUUU@UAGAGSUASAAGUSUAAUSAUSAUGSASAASUOAGUGUUUAUGASGAUAUSAUAUUAGU@OASGAUGAGUUAGAGGSAGG@SA@U@S@
  6440. OUOUUUUUAUUUUUUUUAUUASAGUAGGA@GUAUAGAUOUAASAUSASAUG@SASOASUAGAGSAUGOUSUUAUAGGAS@AGAUAAGGA@@AGUAGGGGAGAG
  6441. UOAAUOUUAUAASUUUAUUUAASAGUOAGSASAGAAUAAGAAUGAGAAGASAGAAGAUAAGUAAGSAAAG@AG@AAUAU@AGAAG@AG@A@@AG@@@@@AGGA
  6442. UAUUAUOUUOUUAUUOGAGASAUUAAAAAAUAGOAAAAGO@AAAGAUAUSAAAUAAAUAGOAGAAGAAA@AGAAAGAG@GAAGA@AGA@AGAU@GAG@AG@@A
  6443. XUUAUAGAUAAAUAAAUAASAUAAUUUUASAGOUUUAUAUAAUAASOAGAUAUAASAGUAUOAAUAUAGAG@SSAGOAGASAUG@AAG@GAAU@@G@G@@GOA
  6444. XUOUOUUGSGUAAAUSAGUAUAAAOOUOUOUUUUUKXXUUUUUUUUUUOUUUUUUUUUAUUXUUAUUUOUUUAUUUAUUAUUUUAUUUAUAUUUUUUAUUAAS
  6445.     XXUA
  6446. XYXY^^
  6447. XYXYXX^YXY
  6448. Y^^^^^Y_Y^^
  6449. Y^^^^^^
  6450. XY_Y_
  6451. -d=dX
  6452. d---d---
  6453. --d---
  6454. 76\B_
  6455. ^Y^^^XY_
  6456. 4AAAu
  6457. aWW]:
  6458. =<:6akU
  6459.       $)
  6460. uupW>W$
  6461. _YYXY
  6462. #A441   
  6463. sF3(##
  6464.   ))$  $
  6465. #11$ 
  6466. (3F]|
  6467. sW9-#
  6468. $&&  $$
  6469. +;&Z|pO:
  6470. Q[e#12
  6471. !-3=]]]]s|||||s|]|||||||||
  6472. |]]s|
  6473. s||||
  6474. zs__93###
  6475.  #$"  $).
  6476. -333333FFFFF3FF3FFFFFWWFWWF9FWWWWFWWFWWWWWWbWbbbbs|
  6477. ||zzsszsWFFFWFWbzzz|bszz||
  6478. z_d_B9&#
  6479.    #"  $.11
  6480. ('('---(((-('('---3933933-399933333-393999999DDD_x
  6481. xg__MFDDDD9339999DD_DD99D__d___ggxxgxxxg_MMB;0###    
  6482.   ).11:
  6483. "_vtr
  6484.     r{jr
  6485. #"((#
  6486. &(((&&&00JJMJ;;000&((0&(&&0(0&000000;;;020000;;;;JJJJ;8888.)&$&$.11115<<::
  6487. >9??9
  6488. # &&)0..122822228<<<<<<<80.........)...2882888821122812588<<<<N<<<<<822212121.1..)))&$&
  6489. :99:9:
  6490.  TAIL
  6491. /data
  6492. dddddddd
  6493. _YXY^^
  6494. YXXY_YX^
  6495. Y^^^^^^
  6496. XY_Y_
  6497. ---Iede
  6498. =YXYX=
  6499. YYXYYYXY
  6500. =<)Wj
  6501. ;&"<>
  6502. Y^^^Y_
  6503. ddd9IIW
  6504. =<<6akk
  6505. ;_M-'wj
  6506. "3_qq`
  6507. 6868666668
  6508. "3U}wf
  6509. =;/!gzO
  6510. `.[$1
  6511. wSqSwS}S}SSSSSgSSS_U_SSkSSESqSSkSSqSqkkkkqk
  6512. UFFZm
  6513. &dPFa
  6514. (!(!4=4=
  6515. -*svud
  6516. ==4=4
  6517. =4=    =4/
  6518. =                    
  6519. uuuuuuuuuu
  6520. qtqvr
  6521. 7TAIL
  6522. 1data
  6523. OUASAUUUUUASUUOAUUAAUUUASAASAUUUUUUAAUUAUAGAUUUUUUSAAUASUUGUAUGAGAAGASAUGU@OAAGAGASAG@SAAAGU@UAUGAS@@G
  6524. UUUUGUAUUUUUUUUUU@UAGAGSUASAAGUSUAAUSAUSAUGSASAASUOAGUGUUUAUGASGAUAUSAUAUUAGU@OASGAUAAGUUAGAGGSAGGASA@
  6525. iXXUOAAUOUUAUAASUUUAUUUAASAGUOAGSASAGAAUAAGAAUGAGAAGASAGAAGAUAAGUAAGSAAAG@AG@AAUAU@AAGAG@AG@A@@AG@@@@@
  6526. kiXUAUUAUOUUOUUAUUOGAGASAUUAAAAAAUAGOAAAAGO@AAAGAUAUSAAAUAAAUAGOAGAAGAAA@AGAAAGAG@GAGAA@AGA@AGAU@G@@@A
  6527. kkXUUAUAGAUAAAUAAAUAASAUAAUUUUASAGOUUUAUAUAAUAASOAGAUAUAASAGUAUOAAUAUAGAG@SSAGOAGASAUG@AAG@GAAU@@@G@@
  6528. kXUOUOUUGSGUAAAUSAGUAUAAAOOUOUOUUUUUKXXUUUUUUUUUUOUUUUUUUUUAUUXUUAUUUOUUUAUUUAUUAUUUUAUUUAUAUUUUUUAU
  6529. (XXUA
  6530. XYXY^^
  6531. XYXYXX^YXY
  6532. Y^^^^^Y_Y^^
  6533. Y^^^^^^
  6534. XY_Y_
  6535. kKA@@
  6536. ---d---d
  6537. YXYXY
  6538. Y^^^^^YXYX
  6539. Y^^^Y_
  6540. aWW]:
  6541. uupW>W$
  6542. _YYXY
  6543. \p[)p)p[\)\\\:6:606:<<<06:\:\\:\\:\\:\::6:\:\0:6:6:06:66
  6544. AAA11$ 
  6545. (3F]|
  6546. sW9-#
  6547. +;&Z|pO:
  6548. Q[e#12
  6549.     =1/gpnA!
  6550. 8888$.
  6551. ...$$88?
  6552. 8.$.$.....$.
  6553. -333333FFFFF3FF3FFFFFWWFWWF9FWWWWFWWFWWWWWWbbbbbbs|
  6554. ||zzsszsWFFFWFWbzzz|bszz||
  6555. zg_dD0&"
  6556.    #"  $
  6557. ('('---(((-('('---3933933-399933333-393999999DDD_x
  6558. xg__MFDDDD9339999DD_DD99D__d___ggxxgxxxd_MMB;0###    
  6559. "_vtr
  6560.     r{jr
  6561. #"((#
  6562. &(((&&&00JJMJ;;000&((0&(&&0(0&000000;;;020000;;;;JJJJ8;888.)&$&$.11115<
  6563. >9??9
  6564. # &&)0..122822228<<<<<<<80.........)...2882888821122812588<<<<N<<<<<822212121.1..)))
  6565. :99:9:
  6566. $TAIL
  6567.     +BiO
  6568. 3data
  6569. AUOUUAUAASUUUAUUUAASAGUOAGSASAGAAUAAGAAUGAGAAGASAGAAGAUAAGUAAGSAAAG@AG@AAUAU@AGAAG@AG@A@@AG@@@@@AG
  6570. UAUOUUOUUAUUOGAGASAUUAAAAAAUAGOAAAAGO@AAAGAUAUSAAAUAAAUAGOAGAAGAAA@AGAAAGAG@GAAGA@AGA@AGAU@G@@@AG@
  6571. AUAGAUAAAUAAAUAASAUAAUUUUASAGOUUUAUAUAAUAASOAGAUAUAASAGUAUOAAUAUAGAG@SSAGOAGASAUG@AAG@GAAU@@@G@@@G
  6572. UOUUGSGUAAAUSAGUAUAAAOOUOUOUUUUUKXXUUUUUUUUUUOUUUUUUUUUAUUXUUAUUUOUUUAUUUAUUAUUUUAUUUAUAUUUUUUAUUA
  6573. XYXY^^
  6574. XYXYXX^YXY
  6575. Y^^^^^Y_Y^^
  6576. Y^^^^^^
  6577. XY_Y_
  6578. YYYYYYY
  6579. YYYYYYYY
  6580. YYXYXY
  6581. YIIIIIII
  6582. IIIIIIII
  6583. IHIHIHI
  6584. IIII-==
  6585. d====
  6586. =d=d====
  6587. kKA@@A@4@@@
  6588. IIIdddI--dIII
  6589. ddYY==
  6590. d=d==
  6591. tI-IIY
  6592. YIIIIII-I==IIIIII-Id==
  6593. YYdddd
  6594. YYYddd
  6595. YX^Xd
  6596. YXYYY
  6597. Y^^^^XYXXY
  6598. Y^^^X
  6599. XY^^Y_
  6600. aWW]:
  6601. _YYXY
  6602. |F3(##
  6603.   ))$  $&&)
  6604. >&SAT
  6605. ~~~~.8
  6606. +;&Z|pO:
  6607. Q[e#12
  6608.     =1/gpnA!
  6609. 88?888$.
  6610. ...$$88?
  6611. 8.$.$.....$.
  6612. -333333FFFFF3FF3FFFFFWWFWWF9FWWWWFWWFWWWWWWbbbbbbs|
  6613. ||zzsszsWFFFWFWbzzz|bszz||
  6614. z_d_B9&#
  6615.    #"  $.1128<
  6616. ('('---(((-('('---3933933-399933333-393999999DDD_x
  6617. xg__MFDDDD9339999DD_DD99D__d___ggxxgxxxg_MMB;0###    
  6618.   ).11:11<
  6619. "_vtr
  6620.     r{jr
  6621. yyyrp
  6622. trrvvvv
  6623. >9??9
  6624.  # &)028882.&&&&&&&#" &&&&)...0100...).0..088888<<528....)1118<<<8858<8811
  6625. <999:
  6626. 39+TXT
  6627. PHL 88TAIL
  6628. f===8
  6629. WZWZW
  6630. p===f
  6631. ,7,,7,,
  6632. zb"$?$$?$$z
  6633. ~k]]?~
  6634. ,,,,,,,{
  6635. {,v,v{+{v{vv{
  6636. ===;    
  6637. ==4;4==
  6638. bbs B
  6639. bbs B
  6640. bbs B
  6641. WednesdayTAIL
  6642. gWC1dayafterTAIL
  6643. gWC2daysafterTAIL
  6644. 56 / 32TAIL
  6645. 63 / 36TAIL
  6646. 64 / 45TAIL
  6647. H!33H
  6648. As of Tuesday, December 27, 1995 TAIL
  6649. !+BiO
  6650. !data
  6651. =+TXT
  6652. =data
  6653. 4TAIL
  6654. E+BiO
  6655. Edata
  6656. ll~l~~LC
  6657. 2/s{*
  6658. ==FH*
  6659. III-III-I-I-I
  6660. ddkdddddddd
  6661. Ydd~Y
  6662. ======d
  6663. d~Y~d
  6664. =5?>?
  6665. Z?>fY
  6666. fZfd|Z|||
  6667. ===d=d=
  6668. =d=~Y'
  6669. =Yd=~YYi
  6670. `%<+@D\??
  6671. |    ;;yr
  6672. !cbc^+3
  6673. <vDb3O?qD@%
  6674. 77777
  6675. 8HFii
  6676. DaaP-]
  6677. qTAIL
  6678. 5+BiO
  6679. 5data
  6680. UAUUUUUASUUOAUUAAUUUASAASAUUUUUUAAUUAUAGAUUUUUUSAAUASUUGUAUGAGAAGUUAUGU@UOAGAGASAG@SAAAGU@UAUG@OG@GG@AAG@
  6681. OUOUUUUUAUUUUUUUUAUUASAGUAGGA@GUAUAGAUOUAASAUSASAUG@SASOASUAGAGSAUGUUSUUAUAGGAS@AAGUGAGGA@@AGUAGGGAAGAGAG
  6682. UOAAUOUUAUAASUUUAUUUAASAGUOAGSASAGAAUAAGAAUGAGAAGASAGAAGAUAAGUAAGSAAAG@AG@AAUAU@AAGAG@AG@A@@AG@@@@@AGAG@A
  6683. XUUAUAGAUAAAUAAAUAASAUAAUUUUASAGOUUUAUAUAAUAASOAGAUAUAASAGUAUOAAUAUAGAG@SSAGOAGASAUG@AAG@GAAU@@G@G@@GOAG@
  6684. XUOUOUUGSGUAAAUSAGUAUAAAOOUOUOUUUUUKXXUUUUUUUUUUOUUUUUUUUUAUUXUUAUUUOUUUAUUUAUUAUUUUAUUUAUAUUUUUUAUUAASAS
  6685.     XXUA
  6686.     XXUO
  6687. ====^
  6688. XYXY^^
  6689. XYXYXX^YXY
  6690. Y^^^^^Y_Y^^
  6691. Y^^^^^^
  6692. XY_Y_
  6693. YYYYYYYY
  6694. YYYYYYY
  6695. IIIIIIIY
  6696. IIIIIII
  6697. YHIHI
  6698. XIHIHHI
  6699. IIIId=
  6700. IIIeY
  6701. kXA@@@6@
  6702. IIII==
  6703. -IIIY=
  6704. IIIIIII
  6705. IIIIIII
  6706. HII=Y
  6707. Ydddddd=
  6708. =Yddddddd
  6709. YYXY^^^^
  6710. Y^^Y_
  6711. 4AAAu
  6712. aWW]:
  6713.       $)
  6714. uupW>W$
  6715. _YYXY
  6716. #A441   
  6717. |F3(##
  6718.   ))$  $
  6719. #11$ 
  6720. (3F]|
  6721. sW9-#
  6722. $&&  $$
  6723. +;&Z|pO:
  6724. Q[e#12
  6725. !-3=]]]]s|||||s|]|||||||||
  6726. |]]s|
  6727. s||||
  6728. zs__93###
  6729.  #$"  $).
  6730. -333333FFFFF3FF3FFFFFWWFWWF9FWWWWFWWFWWWWWWbWbbbbs|
  6731. ||zzsszsWFFFWFWbzzz|bszz||
  6732. z_d_B9&#
  6733.    #"  $.11
  6734. ('('---(((-('('---3933933-399933333-393999999DDD_x
  6735. xg__MFDDDD9339999DD_DD99D__d___ggxxgxxxg_MMB;0###    
  6736.   ).11:
  6737. "_vtr
  6738.     r{jr
  6739. #"((#
  6740. &(((&&&00JJMJ;;000&((0&(&&0(0&000000;;;020000;;;;JJJJ;8888.)&$&$.11115<<::
  6741. >9??9
  6742. # &&)0..122822228<<<<<<<80.........)...2882888821122812588<<<<N<<<<<822212121.1..)))&$&
  6743. :99:9:
  6744. &+BiO
  6745. &data
  6746. :+BiO
  6747. :data
  6748. ;+BiO
  6749. ;data
  6750. H+BiO
  6751. Hdata
  6752. d0dxk
  6753. !T!T[!Tdx
  6754. RTk^bk9_^
  6755. Tdddd60
  6756. 59dkP_
  6757. !T0Tw
  6758. 60606kdd9dd
  6759. w!60609
  6760. ZH,U0
  6761. ^0[x!
  6762. |6dk^t
  6763.  UcZbz9
  6764. C[~ Z1Gb
  6765. d9d6k69[C
  6766. R9999
  6767. z9k999C6
  6768. ^_Pu9R6999
  6769. I+BiO
  6770. Idata
  6771. J+BiO
  6772. Jdata
  6773. c$]c!
  6774. `Iw65
  6775. `wc55
  6776. Ewq5!
  6777. K+BiO
  6778. Kdata
  6779. L+BiO
  6780. Ldata
  6781. !!wE5
  6782. !!wI`^
  6783. 55cIw
  6784. !55Nk
  6785. P+BiO
  6786. Pdata
  6787. ,6\\ff
  6788. }hf\fffffff\\P\\f
  6789. 117717
  6790. 171777
  6791. HQHQH
  6792. HQHHQHHQHHQHQHQHQHHHHQHHQHQHQH
  6793. HHHQHHHHQHHHHHHHHQHQHQHQHQHQHQ
  6794. QHHQH
  6795. HQHHHHHQHHHHQHHHHHQHQHHHQHQHQH
  6796. HQHHHHQHQHHQHQHQHQHHHHHQHQHQHQ
  6797. HHHQHHQHHHHHHHQHHHQHQQHHHQHHQH
  6798. (TAIL
  6799. /INFO
  6800.     SouthEastSCRP
  6801. on openCard
  6802.   global gWCcurrCities
  6803.   global gWCsecities
  6804.   --  global gWCsecitiesInit
  6805.   global gNAVcdev
  6806.   global gWCtomorrow
  6807.   global gWC1dayafter
  6808.   global gWC2daysafter
  6809.   global gWCdate
  6810.   global gWCbtnToCityNav
  6811.   global gWCRegNav
  6812.   global gWCacceptClickDelay
  6813.   global gWCregVoice, gPathAudio, gWCmainmusic
  6814.   initializeCard
  6815.   put empty into gWCsecities
  6816.   put "Atlanta ATL 8" into line 1 of gWCsecities
  6817.   put "Birmingham BHM 10" into line 2 of gWCsecities
  6818.   put "Charleston CHS 24" into line 3 of gWCsecities
  6819.   put "Columbus CSG 28" into line 4 of gWCsecities
  6820.   put "KeyWest EYW 42" into line 5 of gWCsecities
  6821.   put "Miami MIA 71" into line 6 of gWCsecities
  6822.   put "Mobile MOB 73" into line 7 of gWCsecities
  6823.   put "Orlando ORL 82" into line 8 of gWCsecities
  6824.   put gWCsecities into gWCcurrCities
  6825.   putinNewData (the number of this card), gWCcurrCities, 0
  6826.   put empty into gWCbtnToCityNav
  6827.   put "Region Mobile" into line 1 of gWCbtnToCityNav
  6828.   put "NextDay KeyWest" into line 2 of gWCbtnToCityNav
  6829.   put "GoBack KeyWest" into line 3 of gWCbtnToCityNav
  6830.   put "StartOver Miami" into line 4 of gWCbtnToCityNav
  6831.   put "Help Atlanta" into line 5 of gWCbtnToCityNav
  6832.   put empty into gWCRegNav
  6833.   put "MidAtlantic" into line 1 of gWCRegNav
  6834.   put "none" into line 2 of gWCRegNav
  6835.   put "none" into line 3 of gWCRegNav
  6836.   put "none" into line 4 of gWCRegNav
  6837.   if gNAVcdev is "REMOTE" then
  6838.     showInitialLoc
  6839.   end if
  6840.   enableNavBtn
  6841.   --ring bg alarm "alarm_loseClicks" at gWCacceptClickDelay
  6842.   start bg timer "alarm_loseClicks" expire in gWCacceptClickDelay ticks
  6843.   start bg timer open expire in 1 seconds
  6844. end openCard
  6845. 7GRPO
  6846. 7INFO
  6847. VCARD
  6848. Cities_hilitedata
  6849. .TAIL
  6850.  GRPO
  6851. 8CARD
  6852. Citiesdata
  6853. ng bg alarmGRPO
  6854. Columbusdata
  6855. !INFO
  6856. pCARD
  6857. Miamidata
  6858.  INFO
  6859. KeyWestdata
  6860. Charlestondata
  6861. NAMGRPO
  6862. Orlandodata
  6863. NAMGRPO
  6864. Atlantadata
  6865. NAMGRPO
  6866. Mobiledata
  6867. NAMGRPO
  6868. Birminghamdata
  6869. NAM+BiO
  6870. /INFO
  6871. Atlantadata
  6872. k666|]66
  6873. .666"
  6874. ".""$
  6875. 7Wc66
  6876. "66!;$<!
  6877. ]66"k
  6878. 0INFO
  6879. Charlestondata
  6880. "66!;$6!
  6881. ]66"k
  6882. -+...
  6883. "$$$$
  6884. $""$$
  6885. <7A'O
  6886. /<6&    
  6887. k!6<]
  6888. A<66w
  6889. 1INFO
  6890. Birminghamdata
  6891. FFFFFFC2
  6892. F++++++._F
  6893. mm??RR^KRR
  6894. ........
  6895. ........
  6896. $$$$$
  6897.   '5 
  6898. 33-3-
  6899. fy7yk
  6900. 2INFO
  6901. Columbusdata
  6902. J44444
  6903. Uy=yU
  6904. ........
  6905. xxxxxx
  6906. g66.k
  6907. 3INFO
  6908. Mobiledata
  6909. 666666
  6910. 44J_$&&6
  6911. 99^SY
  6912. _d_%<66w
  6913. 4INFO
  6914. Orlandodata
  6915. gsYuuJ
  6916. FAGGG
  6917. 66666
  6918. D+....m
  6919. qSh+$
  6920. ;XXvt
  6921. g...*H
  6922. mm^mmm
  6923. 00bk:
  6924. ;5=<0
  6925. (66&6"..
  6926. (66&6"
  6927. iiiX"11
  6928. 5INFO
  6929. Miamidata
  6930. ]66!k
  6931. i22232
  6932. ........
  6933. TTNPPJ
  6934. &66P'77Q
  6935. jjmjx+
  6936. <66666666666
  6937. 9+BiO
  6938. 6INFO
  6939. KeyWestdata
  6940. UUUUUUUUUUUGSUSUUSUGUUSUSUSUSUUUXKTc\NPNNPPTcTNNNNPNNNP\\MPP\PMh```PJPPJPJ``h
  6941. USUSSSUUUUUAUGUUUUSUUGUSUUUUUUUUKTc\\PPPPPf\fPPNNPNPPPPPMJPPPPP\`\MPP\M\M`hhhhh~
  6942. 0-408%
  6943. SGSASUSUSUXXXKXTcf
  6944. P\PPP\Pffffff
  6945. |TAIL
  6946. "INFO
  6947. Atlanta_hilitedata
  6948. 515]zCz
  6949. E75-]
  6950. _aaa>
  6951. A<6.w
  6952. _aaa>
  6953. a/+J<
  6954. -WUZJ&UZgq
  6955. n$$$$&$
  6956. *INFO
  6957. Charleston_hilitedata
  6958. ]c]w]c//;,
  6959. a"6]]
  6960. (INFO
  6961. Birmingham_hilitedata
  6962. (9B_V
  6963. (99_]
  6964. (9BMu
  6965. (99DL
  6966. (39Dd
  6967. >-bQCs+
  6968. ,qPPr8
  6969. -!)!!! 
  6970. ((3BwLW
  6971. ?emeR
  6972. (((9llwt
  6973. Xmem)
  6974. !!)!!!!
  6975. LLLLLLL
  6976. <]{>%`
  6977. ^]tT&&;E
  6978. ]kJwl
  6979. UIwJoJwI
  6980.     ((((
  6981. 1&&    1&&    
  6982.     i''.N
  6983. Nb77yU
  6984. k!6!k!6!
  6985. Uy77b
  6986. Uy=7=s
  6987. {+BiO
  6988. )INFO
  6989. Columbus_hilitedata
  6990. DDDD}
  6991. /]c]wl
  6992. /OoE}
  6993. qxszzzs
  6994. uruuuu
  6995. ,TAIL
  6996. +INFO
  6997. Mobile_hilitedata
  6998. T,?^{
  6999. {x<(Ik
  7000. ^`,,?
  7001. {Ec///
  7002. W.`E{I
  7003. `IwIwII]wIw]w
  7004. wI{IwIwIwIwEwI
  7005. ...        8
  7006. 'TAIL
  7007. ,INFO
  7008. Orlando_hilitedata
  7009. 888888
  7010. 88888
  7011. T,?,?,{
  7012. ^EJ]X]
  7013. {x/<;</`{
  7014. RFR    J^
  7015. ]/]wJ,
  7016. iiirrmmm
  7017. 00bk:
  7018. -UA//////c]c]xc]wE
  7019. mUUX&
  7020. KOK:qsw
  7021.         lllyh~va
  7022. rrlvw
  7023. rlvvr
  7024. 3TAIL
  7025. .INFO
  7026. KeyWest_hilitedata
  7027. <<>88;88<><>><J>JJJNJNPNPPPPPffffppkkkpkiUXUUiUUUUUUUUUUXUUUeUUXUXK
  7028. yv{rp
  7029. Of]K]KIfE
  7030. 55kk5
  7031. 5kk5-5^
  7032. ?kJJ]
  7033. SUGAGU
  7034. AG@G@A
  7035. @A@@G@
  7036. Atlantadata
  7037. 69/52ADDD
  7038. Atlanta_icondata
  7039. H/H!!H!H!H!
  7040. H!/H!/(H
  7041. t nam+BUT
  7042. AtlantaSCRP
  7043. on mouseUp
  7044.   cityButtonPush (the short name of me)
  7045. end mouseUp
  7046. -------------------------
  7047. on mouseDown
  7048.   cityButtonDown (the short name of me)
  7049. end mouseDown
  7050. -------------------------
  7051. on mouseLeave
  7052.   cityButtonLeave (the short name of me)
  7053. end mouseLeave
  7054. citycode
  7055. downcity
  7056. Charleston
  7057. leftcity
  7058. Birmingham    rightcity
  7059. Button Help
  7060. upcity
  7061. Button HelpTAIL
  7062. Birminghamdata
  7063. 67/54ADDD
  7064. Birmingham_icondata
  7065. $TT1    
  7066. /-H!H
  7067. A+BUT
  7068. BirminghamSCRP
  7069. on mouseUp
  7070.   cityButtonPush (the short name of me)
  7071. end mouseUp
  7072. -------------------------
  7073. on mouseDown
  7074.   cityButtonDown (the short name of me)
  7075. end mouseDown
  7076. -------------------------
  7077. on mouseLeave
  7078.   cityButtonLeave (the short name of me)
  7079. end mouseLeave
  7080. citycode
  7081. downcity
  7082. Columbus
  7083. leftcity
  7084. Columbus    rightcity
  7085. Atlanta
  7086. upcity
  7087. Columbus_icondata
  7088. 5TTTi3T
  7089. Columbusdata
  7090. 75/55ADDD
  7091.  nam+BUT
  7092. ColumbusSCRP
  7093. on mouseUp
  7094.   cityButtonPush (the short name of me)
  7095. end mouseUp
  7096. -------------------------
  7097. on mouseDown
  7098.   cityButtonDown (the short name of me)
  7099. end mouseDown
  7100. -------------------------
  7101. on mouseLeave
  7102.   cityButtonLeave (the short name of me)
  7103. end mouseLeave
  7104. citycode
  7105. downcity
  7106. Mobile
  7107. leftcity
  7108.     rightcity
  7109. Charleston
  7110. upcity
  7111. BirminghamTAIL
  7112. Charlestondata
  7113. 83/55ADDD
  7114. Charleston_icondata
  7115. $TT1    
  7116. /-H!H
  7117. CharlestonSCRP
  7118. on mouseUp
  7119.   cityButtonPush (the short name of me)
  7120. end mouseUp
  7121. -------------------------
  7122. on mouseDown
  7123.   cityButtonDown (the short name of me)
  7124. end mouseDown
  7125. -------------------------
  7126. on mouseLeave
  7127.   cityButtonLeave (the short name of me)
  7128. end mouseLeave
  7129. citycode
  7130. downcity
  7131. Orlando
  7132. leftcity
  7133. Columbus    rightcity
  7134. Button Help
  7135. upcity
  7136. AtlantaTAIL
  7137. Mobile_icondata
  7138. 5TTTi3T
  7139. 56ADDD+TXT
  7140.     INFO
  7141. Mobiledata
  7142. 77/61ADDD
  7143. ort na+BUT
  7144. MobileSCRP
  7145. on mouseUp
  7146.   cityButtonPush (the short name of me)
  7147. end mouseUp
  7148. -------------------------
  7149. on mouseDown
  7150.   cityButtonDown (the short name of me)
  7151. end mouseDown
  7152. -------------------------
  7153. on mouseLeave
  7154.   cityButtonLeave (the short name of me)
  7155. end mouseLeave
  7156. citycode
  7157. downcity
  7158. Button NextDay
  7159. leftcity
  7160. Columbus    rightcity
  7161. Orlando
  7162. upcity
  7163. ColumbusTAIL
  7164. 81/65ADD+TXT
  7165. Orlandodata
  7166. 86/65ADDD
  7167. Orlando_icondata
  7168. 6VV0V66
  7169. iTV=g
  7170. VT3Ti
  7171. =!=!3!3!!!!!=!3==
  7172. ityButtonLeav+BUT
  7173. OrlandoSCRP
  7174. on mouseUp
  7175.   cityButtonPush (the short name of me)
  7176. end mouseUp
  7177. -------------------------
  7178. on mouseDown
  7179.   cityButtonDown (the short name of me)
  7180. end mouseDown
  7181. -------------------------
  7182. on mouseLeave
  7183.   cityButtonLeave (the short name of me)
  7184. end mouseLeave
  7185. citycode
  7186. downcity
  7187. Miami
  7188. leftcity
  7189. Mobile    rightcity
  7190. upcity
  7191. CharlestonTAIL
  7192. KeyWestdata
  7193. 85/75ADDD
  7194. KeyWest_icondata
  7195. 6VV0V66
  7196. iTV=g
  7197. VT3Ti
  7198. =!=!3!3!!!!!=!3==
  7199. upcity
  7200. MiamiT+BUT
  7201. KeyWestSCRP
  7202. on mouseUp
  7203.   cityButtonPush (the short name of me)
  7204. end mouseUp
  7205. -------------------------
  7206. on mouseDown
  7207.   cityButtonDown (the short name of me)
  7208. end mouseDown
  7209. -------------------------
  7210. on mouseLeave
  7211.   cityButtonLeave (the short name of me)
  7212. end mouseLeave
  7213. citycode
  7214. downcity
  7215. Button GoBack
  7216. leftcity
  7217.     rightcity
  7218. Miami
  7219. upcity
  7220. MiamiTAIL
  7221. -INFO
  7222. Miami_hilitedata
  7223. ++2-gtS^&
  7224. 48(2:
  7225. 6666666/+.2$
  7226. 666++.2
  7227. ckPR7
  7228. 8/</c]t]c]c]w]
  7229. 8-xRk
  7230. x////^
  7231. 00-;{
  7232. fNPN(
  7233. fNPNNPPTc
  7234. !UxaL?
  7235. rt name o+TXT
  7236. Miamidata
  7237. 85/74ADDD
  7238. doTAIL
  7239. MiamiSCRP
  7240. on mouseUp
  7241.   cityButtonPush (the short name of me)
  7242. end mouseUp
  7243. -------------------------
  7244. on mouseDown
  7245.   cityButtonDown (the short name of me)
  7246. end mouseDown
  7247. -------------------------
  7248. on mouseLeave
  7249.   cityButtonLeave (the short name of me)
  7250. end mouseLeave
  7251. citycode
  7252. downcity
  7253. KeyWest
  7254. leftcity
  7255. KeyWest    rightcity
  7256. upcity
  7257. OrlandoTAIL
  7258. Miami_icondata
  7259. 6VV0V66
  7260. iTV=g
  7261. VT3Ti
  7262. =!=!3!3!!!!!=!3==
  7263. 9INFO
  7264. Help_Touchdata
  7265. RuA{    
  7266. D27Rc
  7267. RuAg^
  7268.  tgAV
  7269. Pq/=76
  7270. co0?S
  7271.     5677
  7272.     2577
  7273. 7(((    (((>
  7274. ((((((((
  7275. &(((>
  7276. 3(((3
  7277.     2557
  7278. {At,R
  7279. 6Ruto
  7280. =//=?
  7281. A21&c
  7282. t>k31
  7283. b21&o
  7284. co0?S
  7285. ]    &C9
  7286. {%9bB
  7287. ((((((((
  7288. 6666M
  7289. {{{t[wwK
  7290.         2567
  7291. 5??        
  7292. 66666
  7293. ((-J}}i
  7294. }}U<9(
  7295. ((<J}}
  7296. j}}l?((
  7297. J}}}6
  7298. 9(<[}}Q
  7299. }l?((
  7300. J}}}}|||6
  7301. ((>lUUUU}}k9
  7302. i}EUUUUD<((
  7303. P~K}-
  7304. ((<[}}i
  7305. k}}J>((
  7306. G9~(~9G
  7307. s\HK8!567
  7308. <=<=&
  7309. SSSSSS
  7310. 28-5E
  7311. OG2Kuy4
  7312. J!''!
  7313. 6K6c6
  7314. GFSSSSSSSSSSSSSS
  7315. 4"9>II}Y
  7316. }M{%Y.
  7317. _IIQ#4
  7318. ^``uuuuuuuuuuuuuu
  7319. 4)i>^>
  7320. rcYe    MP
  7321. SP(SSQc
  7322. 1'4p4
  7323. x(g7rg6w?8
  7324.         256
  7325. &q:(((:6,75*
  7326. 9&<5od
  7327. ?>?>>?>?>>?>?>?;
  7328. TfRNuuWrftJnsk|hh~srXu
  7329. Ri.i-
  7330. o(~XZ~XZ~XZ~XZ
  7331. $LN~ZX~ZX~ZX(~
  7332.         ?277
  7333. 9(<l}}Q9
  7334. 9(}cD
  7335. kE}J>((
  7336.         2267
  7337. CBCBCCC@@@@@@CCCC@@C@@@@@@@@@@C@C
  7338. ((>l}}
  7339. 8'(GiAy
  7340. 9j}}l?9(
  7341. vm~(&
  7342. ((>J}}
  7343. 8i}}U<9(
  7344. ((<}}}i
  7345. }l?((
  7346. ((.J}
  7347. }}J>((
  7348. ((>U}}k
  7349. mmmmmlmmlml2l5l2555
  7350. mmmmlmlml2l5l25555
  7351. mmmmmlmlml2l2l25555
  7352. mmmmmml|mlmlml2l2l#l555555555$55555$55$555555$5555555$5555
  7353. Y=?45
  7354. =445    
  7355. ^Y_YYY_Y
  7356. =?44    
  7357. =445    
  7358. XYXYY
  7359. YXYYYY
  7360. XYXYXYXXYXY
  7361. Y^^YXY^^
  7362. Y^^^^
  7363. ?5677
  7364. YXXXY
  7365. ?5567
  7366. HHIHH
  7367. SSSSSSSSSSSSSSSS
  7368. ^uuuuuuuuuuuuuuuu
  7369. eII---
  7370. edddde
  7371. ?=^^==d
  7372. =d=dd
  7373. =:^XY
  7374. >?>?>?>?>?>?>??
  7375. Y^YXX
  7376. 4RSRg
  7377. 6RSXe
  7378.         2577
  7379.         2577
  7380. _Y^^^
  7381. 6.m]X
  7382. XYXY_
  7383. _YXXY^^^^
  7384. 7662            
  7385. 7652    
  7386. 56666665
  7387. *+**?
  7388. }JUUUUUUUUUUUUUUUUUJUJJJJJJJJ
  7389. XXXXN
  7390. GGXNNQNXNXXXXX
  7391. XXXXX
  7392. X6XnXN
  7393. XXXXX
  7394. XXnXX
  7395. XXXnX
  7396. SSSSSSSSSSSSSSSS
  7397. Kuuuuuuuuuuuuuuuu
  7398. *+*+:(
  7399. UJUJU
  7400. QXQfx)(>(
  7401. >QQX\tky&33
  7402. >>346    >??>?>>
  7403. >?>?>?>?>>?>?>?;
  7404. GNQX-;:,
  7405.     ?257
  7406. GQGN-:,:
  7407.         2577
  7408. JJJGXNXQ
  7409. Gy6Ny
  7410. QXGQ)>,:B
  7411.         2577R'&x`'&x3
  7412. yu'7x3
  7413. F&&"u&&33
  7414. XNfnXXfN
  7415. XNNXn
  7416. XGGGG
  7417. XXXXXXX
  7418. XXXXXXXXXXXX
  7419. =<%jjt,t,t,t,vtvtvtvt,tt,t,t,t,t,t,v,t,,t,,v,.:;
  7420. >=)??<
  7421. )>mn+1lv
  7422. 77>(/
  7423. /(9>>(
  7424. (>>(9&?x.'
  7425. ??((?
  7426. ?((44((:%((:
  7427. 3(:/3)
  7428. >((7>
  7429. >&((/    ?x.'
  7430. 0??-(
  7431. >9:    .(
  7432. >(9>>((>
  7433. A7>((
  7434. 9(((((((
  7435. &&7&&7~
  7436. &&<=<&<=<&
  7437. <&<=<&
  7438. <&<=<&
  7439. &&97&&
  7440. Y7d^>v
  7441. ~~o~~~o
  7442. ~&~7~~
  7443. ~~o~X~X
  7444. 99999
  7445. 99&9&&
  7446. &X&~o
  7447. &BKg|>&
  7448. X&&&~X
  7449. ><=<7
  7450. }JlZ7Bh@|
  7451. ~&7~&
  7452. &X&&~~XZ
  7453. <=<7666
  7454. io&&&X
  7455. &999&&
  7456. 7dA$|
  7457. d9&XX
  7458. f7B7_
  7459. f,N&'
  7460. >3477
  7461. o&&7&
  7462. &=&<5
  7463. <=&<<
  7464. ~o~&p
  7465. SSSSSSSSWSSSSSSS
  7466. Wuuuuuuuu`uuuuuuu
  7467. ~o~&X
  7468. )o&&o~
  7469. `&&\7
  7470. Xg||$=
  7471.         2577
  7472. &9&9&&&~
  7473. >?>?>?>?>>?>?>?>k&O
  7474. >2<=<
  7475. &7&&&&
  7476. ~o|AZ
  7477. &=&&<=
  7478. R3<((
  7479. >%<((%
  7480. 3(((3((%<((%
  7481. (((3(
  7482. (((    (
  7483. (3(()
  7484. =((?>((>?((
  7485. (>?((
  7486. (((((
  7487. ((977(.
  7488. ~&&&X
  7489. 'o~~'
  7490. =<<44
  7491.         ?277
  7492. *+*+:(
  7493. }5}lKmHX
  7494. X7~Xo~X~
  7495. &=<&=<&<=
  7496. ?>>>3477
  7497.         2267
  7498. ((((((((
  7499. 7652        
  7500. 988^^
  7501. ^^9^x^
  7502. =>            
  7503. =''='=='==
  7504. dGY'=d]
  7505. `d='=
  7506. ~]d''=~
  7507. ]='='
  7508. ??<267
  7509. B==''
  7510. e0$>=
  7511. SSSSSSSSSSSSSSSS
  7512. vdY^'8
  7513. Wuuuuuuuuuuuuuuuu
  7514. `&&\7
  7515. ^^Yn0
  7516.     c:9^^Y    
  7517. ^$2~Y?
  7518. n34of`^|0Y^
  7519. "Z:n 
  7520. [8&_~0}^^'_|["9_
  7521. _9_9^[|_
  7522. fo`_^
  7523. >?>?>?>?>>?>?>?>k&O
  7524. 8_9X^'^g^^g
  7525. _9_'^8X^
  7526. ^8_&_
  7527. ^8_9_8^
  7528. _9_8_
  7529. 8_8^9
  7530. 8_9_8^~=
  7531. ^8_'^
  7532. `X`X`X~X `X]
  7533. `e` Y
  7534. ]X]X`:
  7535. Y`X]X`:
  7536. 7R&&&
  7537. [Za^S
  7538. kSRSkQkQkQkRRk
  7539.     2257
  7540. S7&x`'&x"
  7541. 7&33&&33
  7542. ce`;;#
  7543. &&((&&((
  7544. W&&>W&
  7545. u&&&S
  7546. &&((&&((
  7547. (&&((
  7548. >&&(7
  7549. &&((&`
  7550. {|kmFkp
  7551. &&(9&&((
  7552. (&&9(
  7553. (&7((
  7554. &&((&u
  7555. <9&&<(
  7556. {g(:Be
  7557. 15567
  7558. 9%$34477
  7559. *+**?
  7560. 12257
  7561. P9sE9
  7562.         2577
  7563. rj{,62
  7564. =<;78
  7565. N**;d
  7566.     5567
  7567. ^^g99999(wNM\5D
  7568. ^X***r
  7569. 9oNMM
  7570. {{OA++AP7
  7571. 9gg^|
  7572. &&33'Q
  7573. hD'&i3
  7574. BM{P+
  7575. B{RBBi
  7576. {ig7^^
  7577. W&&&q
  7578. SSSSSSSSSSSSSSSW
  7579. R''&&&&&u
  7580. &7&&&&
  7581. 7('&&79(3
  7582. *+*+:
  7583. 9$Q#M
  7584. DLQQ    
  7585. aja1^
  7586. {Bs^!D3
  7587. >?>?>?>?>>?>?>?;
  7588. 7S&&&
  7589. X3DDIw
  7590. 99P9ii
  7591. 7(((    (({
  7592. &(((>
  7593. k&&&M
  7594. B&&&u
  7595. >&&(&
  7596. >&&(7
  7597. 9>+,33#32
  7598. ivt!!.$<=3=
  7599. <393%3
  7600. &&((&&
  7601. &7((7&
  7602. (&&((
  7603. (&7{Y
  7604. 3<(>>((7>
  7605. >&((&        
  7606. :)3>>
  7607. 77>(>
  7608. >((>>(
  7609. (>>(9&?x.'
  7610. ((?3(
  7611. :(:    ?    4
  7612. )>>((>
  7613. ((77    
  7614.     ((:7
  7615. :(:    ?    4
  7616. <;;2<
  7617. )>>)%
  7618. >?9???(?
  7619. >(((    (((7
  7620. 3(((3
  7621. >(((7
  7622. 4>?>>>347
  7623. ;+*+:
  7624.         2267
  7625.         2577
  7626.     2257
  7627.     2257
  7628.     2567
  7629. *+*+:(
  7630. 77777
  7631. 67777
  7632. :INFO
  7633. Help_Remotedata
  7634. RuA{    
  7635. XzRuAg^    
  7636. RuAg^    
  7637. RuA{    
  7638. {uA9c
  7639.     5577
  7640. )(%B}
  7641.     2557
  7642.     2557
  7643. 3(((3
  7644. (>34477
  7645. RuAgbo
  7646.     5577
  7647. 8S3%8S34
  7648. 0"*813
  7649. cSbZi
  7650. <%X/1
  7651. =//=>
  7652. A21&c
  7653. )?(z*
  7654. 6666666666666
  7655. (((?((9>
  7656.         2567
  7657. 66666
  7658. (((((9((
  7659. (9(((((9
  7660. ((<J}}i
  7661. }}U<((
  7662. *+**?(
  7663. ((<J}}
  7664. j}}l.((
  7665. J}}}6
  7666. (9<J}}Q
  7667. }l?((
  7668. J}}}7
  7669. ((>l}}k9
  7670. i}}U-((
  7671. P~K}-
  7672. (9<J}}i
  7673. k}}J>(9
  7674. PJKK-766
  7675. ((<l}Ei
  7676. Q}EJ-((
  7677. G9~(~9G
  7678. s\HK8!567
  7679. <=<=&
  7680. SSSSSS
  7681. 28-5E
  7682. Ss?Q=
  7683. S==SS
  7684. es?S=
  7685. uBBH=    ?557
  7686. J!''!
  7687. 6K6c6
  7688. GFSSSSSSSSSSSSSS
  7689. 4"9>II}Y
  7690. }M{%Y.
  7691. _IIQ#4
  7692. ^``uuuuuuuuuuuuuu
  7693. 4)i>^>
  7694. rcYe    MP
  7695. SP(SSQc
  7696. 1'4p4
  7697. g7rg6w?8
  7698.         256
  7699. &q:(((:6,75*
  7700. 9&<5od
  7701. ?>?>>?>?>>?>?>?;
  7702. TfRNuuWrftJnsk|hh~srXu
  7703. Ri.i-
  7704. o(~XZ~XZ~XZ~XZ
  7705. $LN~ZX~ZX~ZX(~
  7706.         ?277
  7707. 9(<l}}Q9
  7708. 9(}cD
  7709. kE}J/((
  7710.         2267
  7711. 7523    
  7712. 9(<J}}i
  7713. !coQ9
  7714. }J/((
  7715. ((>l}}
  7716. 8'(GiAy
  7717. 9j}}l?((
  7718. vm~(&
  7719. (9<l}}i
  7720. }l?((
  7721. ((?J}
  7722. }}J/((
  7723. *+**?(
  7724. ((>UUUU
  7725. k}}UUUU
  7726. *+*++
  7727. Y:,55
  7728. ^^XY^
  7729. ^Y_YYY_Y
  7730. =?44    
  7731. =444    
  7732. =444    
  7733. =444    
  7734. =444    
  7735. Y^^^XXY^^^
  7736. ^^^^^YXY^^Y
  7737. XY_YXY^
  7738. Y^^^YXY_Y
  7739. XY^^^^^
  7740. YXY^^^^YX
  7741. ^^^Y_YX
  7742. Y^^^^
  7743. YYYXY
  7744. HHIHH
  7745. SSSSSSSSSSSSSSSS
  7746. ^uuuuuuuuuuuuuuuu
  7747. eII---
  7748. edddde
  7749. ?=^^==d
  7750. =d=dd
  7751. =:^XY
  7752. >?>?>?>?>?>?>??
  7753. 4    SRSZ
  7754. XXXYY
  7755. 5RSRg
  7756.     ?257
  7757.     ?257
  7758. 53(>(
  7759. (((43(((    
  7760. ((:&7:(9
  7761.     (9(3
  7762. ((    (((>
  7763. ((    (((/7:(9
  7764.     (((3
  7765. ((>?(9    (?
  7766. 4RSRg
  7767. 6RSXe
  7768.         2577
  7769.         2577
  7770. _Y^^^
  7771. 6.m]X
  7772. XYXY_
  7773. _YXXY^^^^
  7774. 7??_SR
  7775. RQRRQ
  7776. 66.[X
  7777. SRSRRRRRSRRSRRQRS
  7778. RRQRQ
  7779. 7652    
  7780. 56666665
  7781. }JUUUUUUUUUUUUUUUUUJUJJJJJJJJ
  7782. XXXXN
  7783. GGXNNQNXNXXXXX
  7784. XXXXX
  7785. X6XnXN
  7786. &&&>&&&>
  7787. >&7C>39
  7788. d&&ud&
  7789. u((&&((
  7790. &&&&&C
  7791. XXnXX
  7792. XXXnX
  7793. SSSSSSSSSSSSSSSS
  7794. nXXXX
  7795. QNGf2:&
  7796. R&&&u
  7797. (&&((
  7798. ::!=        2577
  7799. '&-/'
  7800. >?>?>?>?>>?>?>?;
  7801.         2477
  7802. ((:74<((
  7803.     /((7
  7804. >9((    
  7805. (    ((%
  7806. >(((    (
  7807. )((    9(
  7808. (((((9(
  7809. GNQX-;:,
  7810.     ?257
  7811. GQGN-:,:
  7812.         2577
  7813. JJJGXNXQ
  7814. Gy6Ny
  7815. QXGQ)>,:B
  7816.         2577R'&x`'&x3
  7817. yu'7x3
  7818. F&&"u&&33
  7819. GQQN$>;:
  7820.     ?257
  7821. 9&&((
  7822. XNNXn
  7823. XGGGG
  7824. XXXXXXX
  7825. XXXXXXXXXXXX
  7826. =<%jjt,t,t,t,vtvtvtvt,tt,t,t,t,t,t,v,t,,t,,v,.:;
  7827. >=)??<
  7828. )>mn+1lv
  7829. 77>(/
  7830. /(9>>(
  7831. (>>(9&?x.'
  7832. ??((?
  7833. ?((44((:%((:
  7834. 3(:/3)
  7835. >((7>
  7836. >&((/    ?x.'
  7837. 0??-(
  7838. >9:    .(
  7839. >(9>>((>
  7840. A7>((
  7841. 9(((((((
  7842. &&7&&7~
  7843. &&<=<&<=<&
  7844. <&<=<&
  7845. <&<=<&
  7846. &&97&&
  7847. Y7d^>v
  7848. ~~o~~~o
  7849. ~&~7~~
  7850. &X@gZ$
  7851. X~Xo&X
  7852. &9&7&&
  7853. &BKg|>&
  7854. X&&&~X
  7855. ><=<7
  7856. }JlZ7Bh@|
  7857. ~&7~&
  7858. &X&&~~XZ
  7859. <=<7666
  7860. io&&&X
  7861. &999&&
  7862. 7dA$|
  7863. d9&XX
  7864. >7BA5<
  7865. 9?=    2577
  7866. o&&7&
  7867. &=&<5
  7868. <=&<<
  7869. ~o~&p
  7870. SSSSSSSSWSSSSSSS
  7871. Wuuuuuuuu`uuuuuuu
  7872. ~o~&X
  7873. )o&&o~
  7874. lJk~g|
  7875.     ?25/
  7876. 7^M37^
  7877. S&&xl&&
  7878. &7((7&
  7879. 8X&u)
  7880. &&((&
  7881. 'V&u)
  7882. io~&X
  7883. ~&~X~&
  7884. &9&9&&&~
  7885. >?>?>?>?>>?>?>?>k&
  7886. >2<=<
  7887. &7&&&&
  7888. ~X~7~Bh$&=&&
  7889. X&&7&&
  7890. &&&X~$
  7891. ~&&&X
  7892. 'o~~'
  7893. =<<44
  7894.         ?277
  7895. X&~&7~9
  7896. &&9&G
  7897. X~o~o~X~m~BhgZgg|ZZK%v
  7898. $Z$?$
  7899.         2267
  7900. ((((((((
  7901. 7652        
  7902. ^^&Y^Y
  7903. =?            6
  7904. %        66
  7905. 88^'d
  7906. ]=='=
  7907. ]'='=d
  7908. &??5567
  7909. B=d'=
  7910. SSSSSSSSSSSSSSSS
  7911. Wuuuuuuuuuuuuuuuu
  7912. 63n:Y
  7913. B!>dB
  7914. `&&\7
  7915. Z*>5=
  7916. e&_^~    &_
  7917. =|^^O2
  7918. 88X n
  7919. o0f^^h0Y
  7920. Y[7X4|XZ0
  7921. _&_|0
  7922. '^[o6o]_&_
  7923. ^f|^io^9_
  7924. >?>?>?>?>>?>?>?>k&
  7925. ^Y^g^
  7926. _9_9_
  7927. 8_9:d
  7928. ^8^^9_
  7929. ^gYX9X9
  7930. XY`X]^`e
  7931. `XY`e`Y`eY
  7932. `X`e`:d
  7933. __98'_9_
  7934. Y'''Y
  7935. ''=d'=
  7936. 7R&&&
  7937. gnmbY^f\
  7938. kStS]
  7939. 7752        
  7940.     2257
  7941. S7&x`'&x"
  7942. 7&33&&33
  7943. B7&&d
  7944. W&&&q
  7945. O'7&i
  7946. [->=v
  7947. W&&>W&&>
  7948. u&&&S
  7949. &&((&&((
  7950. (&&((
  7951. >&&(7
  7952. &&((&`
  7953. {|kmFkp
  7954. &&(9&&((
  7955. (&&9(
  7956. (&7((
  7957. &&((&u
  7958. &&99'&n
  7959. <9&&<(
  7960. p988H
  7961. 15567
  7962. {$34477
  7963. 42567
  7964. "    2577
  7965. 12257
  7966. C^^g99
  7967. ^ACz$ZBmw:
  7968.         2577
  7969. N**;d
  7970.     5567
  7971. *+*+:(
  7972. 99gg^
  7973. NwttB
  7974. z4477
  7975. 9^X***r
  7976. 9oNMM
  7977. N89(v{$
  7978. {{OA++AP7
  7979. 9gg^|
  7980. &&33'Q
  7981. hD'&i3
  7982. {M{P+
  7983. B{RBBi
  7984. {ig7^^
  7985. W&&&q
  7986. SSSSSSSSSSSSSSSW
  7987. C^w7[#
  7988. S&&&u
  7989.     &&70
  7990. 6&&(&
  7991. DL7@    
  7992. >?>?>?>?>>?>?>?;
  7993. 77651"
  7994. 9xM~G
  7995. "(((3((%<((%
  7996. (((7(((3(
  7997. ((    (((>
  7998. (((33(((    
  7999. )((    (
  8000. ((3<((
  8001. 4(>3(((
  8002. 7S&&&
  8003. +.'^g
  8004. X3DDIw
  8005. 7(((    (({
  8006. &(((>
  8007. 9!N))
  8008. :"{99
  8009. >&&(&
  8010. >&&(7
  8011. 9>+,33#32
  8012. ivt!!.$<=3=
  8013. <393%3
  8014. &&((&&
  8015. &7((7&
  8016. (&&((
  8017. (&7{Y
  8018. >?9???(?
  8019. >(((    (((7
  8020. 3(((3
  8021. >(((7
  8022.     0257
  8023.         2577
  8024.     2257
  8025. >INFO
  8026. Help_BackToMap_hilitedata
  8027. >(()K
  8028. K=((>
  8029. :[[Fa
  8030. dYY==d
  8031. =='=d
  8032. u63Z=Y
  8033. 9/%Y4=%
  8034. 9~Y70
  8035. Y3?d^
  8036. ^x^^&2
  8037. -_    5%
  8038. 2|^^O 
  8039. oY^^i0
  8040. ^Y[n6[
  8041. YoZ^^
  8042. 0|_'^
  8043. Z4o0]
  8044. fo^9^Krd^[_
  8045. 8_8_9
  8046. ^9^^^`X
  8047. YOX`}X~XY`
  8048. Y`X]^
  8049. X `e`e`e
  8050. *TAIL
  8051. me of me+BUT
  8052. <INFO
  8053. Help_BackToMapSCRP
  8054. on mouseUp
  8055.   global gWChilitedBtn
  8056.   global gNAVcdev
  8057.   global gWCcd_or_bg
  8058. --  global gNAVEpcotPath
  8059.   global gWCpath
  8060.   global gWCvoicePath
  8061.   global gWCmainMusic
  8062.   global gpathAudio
  8063.   clearIdleAlarm
  8064.   play stop
  8065.   send mouseLeave to cd btn (the short name of me)
  8066.   send mouseDown to cd btn (the short name of me)
  8067.   send mouseLeave to cd btn (the short name of me)
  8068.   send mouseDown to cd btn (the short name of me)
  8069.   send mouseLeave to cd btn (the short name of me)
  8070.   lock screen
  8071.   if gNAVcdev is "REMOTE" then
  8072.     hide cd bmp "Help_Remote"
  8073.   else
  8074.     hide cd bmp "Help_Touch"
  8075.   end if
  8076.   hide cd btn "Help_BackToMap"
  8077.   unlock screen
  8078.   enableNavBtn
  8079.   put "Help" into gWChilitedBtn
  8080.   if gNAVcdev is "REMOTE" then
  8081.     put "Background" into gWCcd_or_bg
  8082.     send mouseDown to bg btn "Help"
  8083.   end if
  8084.   start cd timer "alarmSelect" of cd "National" expire in 2100 ticks
  8085.   --play file (gNAVEpcotPath & gWCpath & gWCvoicePath & gWCmainMusic) nowait
  8086.   -- set the soundFile of bg snd "main" to 
  8087.      (gNAVEpcotPath & gWCpath & gWCvoicePath & gWCmainMusic)
  8088.   set the soundFile of bg snd "main" to 
  8089.      (gpathAudio & gWCmainMusic)
  8090.   play bg snd "main"
  8091. end mouseUp
  8092. -------------------------
  8093. on dismissPopup
  8094.   global gWChilitedReg
  8095.   global gNAVcdev
  8096. --  global gNAVEpcotPath
  8097.   global gWCpath
  8098.   global gWCvoicePath
  8099.   global gWCmainMusic, gPathAudio
  8100.   send mouseLeave to cd btn (the short name of me)
  8101.   play stop
  8102.   lock screen
  8103.   if gNAVcdev is "REMOTE" then
  8104.     hide cd bmp "Help_Remote"
  8105.   else
  8106.     hide cd bmp "Help_Touch"
  8107.   end if
  8108.   hide cd btn "Help_BackToMap"
  8109.   unlock screen
  8110.   enableNavBtn
  8111.   put "Help" into gWChilitedReg
  8112.   if gNAVcdev is "REMOTE" then
  8113.     put "Background" into gWCcd_or_bg
  8114.     send mouseDown to bg btn "Help"
  8115.   end if
  8116.   start cd timer "alarmSelect" of cd "National" expire in 2100 ticks
  8117.   --play file (gNAVEpcotPath & gWCpath & gWCvoicePath & gWCmainMusic) nowait
  8118.   set the soundFile of bg snd "main" to 
  8119.      (gPathAudio & gWCmainMusic)
  8120.   play bg snd "main"
  8121. end dismissPopup
  8122. -------------------------
  8123. on mouseDown
  8124.   global gWCacceptMouseClicks
  8125.   clearIdleAlarm
  8126.   if gWCacceptMouseClicks is not "false" then
  8127.     do "show cd bmp" && quote & (the short name of me) & "_hilite" & quote
  8128.   end if
  8129. end mouseDown
  8130. -------------------------
  8131. on mouseLeave
  8132.   do "hide cd bmp" && quote & (the short name of me) & "_hilite" & quote
  8133. end mouseLeave
  8134. downcity
  8135. leftbutton
  8136. leftcity
  8137. rightbutton
  8138.     rightcity
  8139. upcity
  8140. ~~~~~~~SOND
  8141. @INFO
  8142. AGM:Desktop Folder:POMO folder:Audio:TchUSmsc.aif
  8143. mainTAIL
  8144. "bkgd
  8145. Zdata
  8146. ~~~~~~~
  8147. v``Q!"
  8148. <****
  8149. v``W'"
  8150. v```'$
  8151. 117717
  8152. vvxxvvv
  8153. vv``''$"
  8154. 0-08<
  8155. 171777
  8156. vvv~xv
  8157. ~~~~~
  8158. ~vxvv
  8159. pvvvvv
  8160. vxvvv
  8161. x~xvv~v~
  8162. v~vxx
  8163. xvxvv
  8164. vxvvv
  8165. ~~~~~~
  8166. 1!171717
  8167. vv``''11
  8168. (7(7(3('
  8169. ~xvxxx
  8170. vvvvv
  8171. 7717""
  8172. v```'11$
  8173. vvvvvvvv
  8174. vpvvvu
  8175. vvvvvvsv
  8176. xx~vx
  8177. vv`fpvvf``fv
  8178. >71'!!1771
  8179. 37,(7
  8180. ~~~~~~~
  8181. ~~~~~
  8182. 7!W``vvvvvvvvs
  8183. v`HW4
  8184. !WWWv
  8185. ""'>`
  8186. v`RB4"
  8187. "7!W``v
  8188. ""'/``p
  8189. xxxxx~~
  8190. "$'/`fpx
  8191. ~~~~~~
  8192. pvvvpvv
  8193. {y    pv
  8194. :(???
  8195. nLGH)
  8196. ??=8=
  8197. ==:?:
  8198. ?::?=:
  8199. ?=8?888:=8
  8200. 8:=:=
  8201. 8==:?
  8202. ?=:?=8===?:
  8203. ::?==:?==
  8204. ????==:
  8205. y~if"
  8206. ?=DFyF
  8207. 88:8=888=:8=8?=88
  8208. 8:??=8==8:::?=?===:8
  8209. :?:?===
  8210. ?=8:?===
  8211. ?:==?
  8212. ==???
  8213.     ppv`
  8214. p~cf&(:
  8215. =DFFD
  8216. ??:??=:?
  8217. vpzi"
  8218. =8:88=:=8:8
  8219. 8:=8:?
  8220. 8:==8=::?
  8221. ?:=?88:=8?==
  8222. ?=8==
  8223. ::=?=:===
  8224. ?;?;;
  8225. 8888:=8??=
  8226. ?=?======:?:
  8227. :?:::8??
  8228. ???:???=??
  8229. ?==??
  8230. ???==
  8231. ?????
  8232. =8?:88?
  8233. {iff/
  8234. :==88
  8235. =8:==8:=8
  8236. 88?==88:8:==?:8::
  8237. =8?===?=:?
  8238. ????=??=
  8239. ?::??
  8240. ?8==?
  8241. =?=??
  8242. ??????????
  8243. ~~~~~
  8244. ==88:=8
  8245. 8=8==8?::==?
  8246. :::?=8
  8247. ===?8?8:?
  8248. :?:?8
  8249. ??????????
  8250. 88:888:8
  8251. yU[[;
  8252. :88=8
  8253. :?=8:8=88
  8254. 88::::
  8255. 88===888==??===8
  8256. :??=:
  8257. ?????
  8258. yyBU;;
  8259. 888:8
  8260. :?=:?=8:
  8261. ====:?
  8262. :=?=?=
  8263. ????=?
  8264. ????=
  8265. :=?==:?:?===8?
  8266. :==8?8:
  8267. y}}}}}}
  8268. ???=?
  8269.                     
  8270. 888==
  8271. :88:8888
  8272. :?8===
  8273. :==8?8?=
  8274. ?====
  8275.                     
  8276. yy|B;;;
  8277. {y{{{y
  8278. 50NN{g
  8279. 0~C~s
  8280. kv}{`\ZY:
  8281. |y}|;;?;
  8282. yyqqq
  8283. 88:888
  8284. ::8=8
  8285. ~lx~~LC
  8286. 88=8=::88=88=8=8
  8287. 2/sG3
  8288. 88=8=:88
  8289.     <lZ3
  8290. 9=_y*
  8291. {~~~{~{
  8292. 88888=;
  8293. !Z'/0
  8294. II-II-I5I-F
  8295. 5==1{,
  8296. 8888=
  8297. 888888
  8298. k=dkd
  8299. dddY~Yd~
  8300. ~~{{~~
  8301. 88888
  8302. :888888
  8303. ,(,,((
  8304. 5!p2 
  8305. 8:888
  8306. ====='Y
  8307. 88888
  8308. 7f>%Zd~Z%
  8309. Z|g|Z|
  8310. ~~~~~~
  8311. 18..8.8
  8312. \\\T\
  8313. 88888
  8314. r4c-8
  8315. {~~~{~{~
  8316. Oa(+.(
  8317. otECY
  8318. vvvxx~~~
  8319. 629262(RyqR
  8320. ;?$-"
  8321. vvvvv
  8322. uhuxmuxu
  8323. vvsvsvvv
  8324. 8    1=:
  8325. vvvvxvv~v~~{{~
  8326. 0NNEu
  8327. ~EE]0
  8328. 0ME]u}E]
  8329. u]EEE]E
  8330. xMMN5
  8331. 0NCMs
  8332. sMC\5
  8333. 5*F~sl88
  8334. sFF]5
  8335. 0PCFN
  8336. .119    
  8337. 368;11    
  8338. D---d
  8339. "zLqq
  8340. x~~~~
  8341. '=d=L=
  8342. =%='=d'LY
  8343. vvxx~x~
  8344. Y~YYv
  8345. ~~{~~~
  8346. =df%n
  8347. vvxvvv
  8348. LZLZ(
  8349. +r`Pb
  8350. -P-;g
  8351. ;??;;
  8352. vrvyvy
  8353. ;?;?;;
  8354. :8::L8
  8355. ;?;?;?
  8356. vvxxv
  8357. xGGG?
  8358. njnj;?;?
  8359. Jrnq,
  8360. <<<<#&
  8361. <<<#<#
  8362. <<<#<#
  8363. #8?<'
  8364. `%<+@D\??
  8365. 2!!!2''''''d
  8366. +++!!.
  8367. !2!++8>!
  8368. +727.&ggf@m
  8369. mtttr~s
  8370. ,,,>-'?
  8371. `{p==//T
  8372. zyrzv
  8373. ??;??;
  8374. (*qL[L8
  8375. QQRT7
  8376. yyyyyq
  8377. yyyyyyyy
  8378. &2~S]
  8379. YgULY_
  8380. !JpxZ.
  8381. 7<77777
  8382. 6~;;1
  8383. <~;;1
  8384. -?r,C
  8385. !JdsO$
  8386. i===\
  8387. !7LgR
  8388. +^+Mga
  8389. .3avR
  8390.  L^vN
  8391. ~ML?(,
  8392. Loeo#
  8393.  =M|\
  8394. +3M!9!M3
  8395. :-MrR
  8396. 4JdwP$
  8397. I]45)
  8398. ^#(Mao
  8399. x8!?Ul
  8400. &[MU7$3
  8401. +3MeW
  8402. Aa=_"
  8403. ZaM^(
  8404. e<<=Mvr\(
  8405. 77?[Tc
  8406. +2-fS]C"J}|{2 2+222?+
  8407. 2?MeN
  8408. e<<3avJV
  8409. AA\]        
  8410. u!M5T
  8411. /(oT?-cO#
  8412. Fhs{F
  8413. ]Rs~W\C1
  8414. *88*4
  8415. "RWR~qSV\0
  8416. "C\W~s~WO
  8417. ]Ss~S]
  8418. ,:(()
  8419. (((,,
  8420. "((("
  8421. ((,-(
  8422. }}}}y
  8423. :(::8(:?
  8424. Y?S.-L
  8425. 88888=
  8426. =:(*(
  8427. (*8::8
  8428. {{{{{
  8429. a{g6M{
  8430. M*M6cg2
  8431. tL?]X;X
  8432. tdJ(P.-L
  8433. hhlh?
  8434. MMZo"
  8435. ?M/My
  8436. gggvvgvv
  8437. ~g|ggg
  8438. ggggg
  8439. Whhh?
  8440. mog||og
  8441. MMrrytrdr|t|o|oo
  8442. |t|o|to
  8443. gdg|to
  8444. g|ggvgv
  8445. Whhh?
  8446. ggovvgvv
  8447. g||gtg|g
  8448. vvvvvvvv
  8449. 1rzKz
  8450. 1    &NgEp
  8451. ti}H<
  8452. >>444
  8453. iwff<
  8454. wwff;
  8455. 5yNIv
  8456. zrA~1$gEga
  8457. 5WI}v
  8458. !ELrm
  8459. Et    1O
  8460. $tLgh
  8461. CzrK11
  8462. 2&fwej
  8463. zCzz111
  8464. 11nIE}
  8465. YJY$YL
  8466. EEgj    
  8467. zzCr1Y}C}
  8468. ]_T        
  8469. %8U^f{
  8470. _rKr-1nLV}
  8471. ,G]]x
  8472. 515]zCz
  8473. E75-]
  8474. _aaa>
  8475. >>CPll    
  8476. wLWf 
  8477. A<6.w
  8478. _aaa>
  8479. 1!ELLo
  8480. ]TZI    
  8481. ,%,%    
  8482. 8CCA{
  8483. k6!+N
  8484. !gaaS
  8485. !tLtm        
  8486. <C>Cl
  8487. wow}lwll
  8488. l}ff1
  8489. !)!NLLL+
  8490. ;<]/KMaa>,
  8491. !g{fd
  8492. T]G;#H]
  8493. }}}}}
  8494. ThV}jlh
  8495.                     
  8496. =.8'=
  8497. >CPYl
  8498. wwww}o
  8499. wZIU-
  8500. -WUZJ&UZgq
  8501. LtLp    
  8502. g]]ig]]
  8503. ZZSE    
  8504. '>P[Cg
  8505. +qaaN
  8506. 511YLE}
  8507. O)^w/
  8508. )m^1)m
  8509. .KVZx
  8510. }&uu"
  8511. n$$$$&$&&&&&&//!N;J%!+!J/
  8512. %    '#fHwi
  8513. lwlL; 
  8514. Lmmq!
  8515. .66..66.
  8516. k.66I.<6"
  8517. KrzC1
  8518. 11NLtL
  8519. ]T@E    
  8520. 44p44p
  8521. ?93P44p'
  8522. }}}}}}}}
  8523. }}}}}}}
  8524. _`s--,
  8525. R1115
  8526. |C@\C0\Jd
  8527. wN0C>ZAy
  8528. yK[9CF\O
  8529. WZP0FA
  8530. K[9NE
  8531. ,%fll
  8532. 111c    
  8533.     %    %'
  8534. }}}}}
  8535.   '5 
  8536. f}}}}
  8537. 1111a
  8538. Z~^SIDl
  8539. 44/1/
  8540. %'5Cf
  8541. k66(k66"
  8542. }}}ww
  8543. Uy7yU
  8544. 11+__"
  8545. fy7yk
  8546. Onnnn
  8547. kklli
  8548. ::::::
  8549. :::::
  8550. :::::
  8551. ls=sU
  8552. :::::
  8553. :::::::
  8554. :::::
  8555. 4::::
  8556. :::::4
  8557. ::4::
  8558. :::::4
  8559. ::::::
  8560. ::::::
  8561. :::4:
  8562. =========
  8563. }}}}}
  8564. Uy7yU
  8565. :::::::::
  8566. :::::
  8567. ::::<
  8568. _bb_=
  8569. 7dAf}
  8570. f777Q
  8571. P!k66!
  8572. ::4:::
  8573. $::::::::
  8574. ::::::
  8575. hRh1)
  8576. 4:::<
  8577. :::4:
  8578. :::::
  8579. 4:4:::4:
  8580. ::4::
  8581. :::::
  8582. :4:4:
  8583. :::::::::
  8584. :::4:::
  8585. :4:4::::
  8586. :::::::
  8587. ====5
  8588. }}}}}}
  8589. :::::::::::::::::
  8590. :4:::
  8591. <4:::
  8592. :<:44
  8593. :::::::::
  8594. :<:::
  8595. :::::4:::
  8596. :44:::
  8597. :::::4
  8598. ::::4
  8599. ::<:::
  8600. ::%qF>ZCL\`N:4
  8601. EI-CFtX:E\hh:
  8602. 4:HHH>ZC
  8603.                         
  8604. :444:
  8605. l4:4:
  8606.                     
  8607.                         
  8608. NbqU:
  8609. Uy7yU
  8610. :4:<:
  8611. :4:4:
  8612.                         
  8613.                                                 
  8614. Uy7yU
  8615. ::4::<:
  8616.                         
  8617. ::4::
  8618. ffffffnlo
  8619. ::<N\yb:4
  8620.                     
  8621. >&7>7
  8622. fffffffff
  8623. ::::::
  8624. ==55=
  8625. {[/YQ
  8626. ffffff
  8627.                                     
  8628. w}}}}
  8629. xmxmk\ZQG
  8630. xmmmUZ\2
  8631. >AfCfffolrffff
  8632. :<4::
  8633. :4::::4
  8634. %7<>f}}}
  8635. nnH/66!
  8636. !6!a!6!k
  8637. k.66r.66
  8638. 4:444
  8639. 5=5=,
  8640. %>>>ACAJCJCCC><
  8641. k!6!a!6!
  8642. .66a.66k
  8643. !66a!66k
  8644. ====5
  8645. 2455/
  8646. 7155,
  8647. 2455/ps
  8648. 74155
  8649. 2455/
  8650. spz}v
  8651.     8    '    
  8652. ^)m))^)-?
  8653. ^))m))mC
  8654. '8'88
  8655. 4p44P'
  8656. 44p44p
  8657. spz}v
  8658. Chhf+hhhHq|hH
  8659. +Vq{{>
  8660. ChhX+
  8661.         =<>
  8662. Ch>>h
  8663. .qN>HZ
  8664. Vqu-HXhp+
  8665. 0Ch>>Hh
  8666. '%'''
  8667. .%'''='f
  8668. %    ''''
  8669.                     %    ,
  8670.                         
  8671. qqh%&
  8672. %        '    
  8673. w_%Wrv
  8674. ,...'z
  8675. ..8.8.l
  8676. 0415,
  8677. q-Yhwyy
  8678. '%    '%0
  8679. sbzs    
  8680. 55=5=
  8681. /ii{h
  8682. YgldH
  8683. 5=55===
  8684.                         
  8685. 9"'SU"
  8686. %%Qbq
  8687. 511,m
  8688. ttttn
  8689. wqqQU
  8690. !{xeX...
  8691. t~nQ'
  8692. amvM=K
  8693. .6677/<.
  8694. r<66K
  8695. tttlt
  8696. 4?/-$
  8697. JJJ4'+
  8698. kq7qU
  8699.     11"-`kga
  8700. Q=77f
  8701. (,m\{h
  8702. ttvvt
  8703. 6&&Tlrv
  8704. aa__27
  8705. 1"+-k~ga
  8706. k666k666
  8707. &(&Zrrv
  8708.     {tnZ(-
  8709. (666/
  8710. <0:04
  8711. (,h\{x
  8712. 4:<:44
  8713. vaf`(6
  8714. A]A]A]A]//]<<<6/<666666
  8715. <044+6
  8716. 2++?%66"
  8717. w666W
  8718. (,h\{h
  8719. yvytv
  8720. }tVe$'
  8721. //666
  8722. ::<0:
  8723. {{hQ<
  8724. 6::86
  8725. (`sss
  8726. #7241666
  8727. ytyh,
  8728. M???f6<6"
  8729. 665<66-
  8730. !66+!6/
  8731. k!66]
  8732. \bmh%>(/
  8733. ?::::::4
  8734. Qv}x-
  8735. =p|~H<4<0
  8736. yyrly
  8737. r`ssssssJMM
  8738. `ss>J
  8739. y"6/$&$&
  8740. ::6:666-
  8741. >->->-
  8742. -99^SY
  8743. 7+6/$
  8744. _d_%<66w
  8745. ,mb{h%.>/
  8746. 2+4+D66
  8747. +21/hfbm
  8748. yw+xww
  8749. ''        '
  8750. 8865!
  8751. .'    '.
  8752. 888888
  8753. AIv}vvrO
  8754.   '    %',.%',
  8755. .'.8''8.
  8756. 2<2666
  8757. <U<KU
  8758. WW<<>5@@I    
  8759. P\ZaOOOk
  8760. ~k?A4!
  8761. (!m\kc
  8762. ~~}~suss
  8763. ssu~u
  8764. 811118118
  8765. 88>>8+>
  8766. 881111
  8767. 8888888
  8768. --7--
  8769. fcff41466][_m
  8770. 8811    
  8771. 8811    
  8772. $="F_LL
  8773. 6]6/!]6/
  8774. k.66]
  8775. ibmh%>(/
  8776. 7-(--
  8777. yWTPRR4124
  8778. L15188888>881
  8779. .>1111111
  8780. xpWfV^f_ >
  8781. 4][r    
  8782. 9=&99
  8783. 6T[BN
  8784. !++<2
  8785. .=.==.====
  8786.             @[Q==
  8787. +^]&`
  8788. 9SSoSbq
  8789. 26426
  8790. NNW]NDY[#
  8791. ======
  8792. 666:6
  8793. <0-<-
  8794. -8---*
  8795. *-**[
  8796. tqruzr
  8797. ***-))
  8798. qb.95
  8799. ===,,
  8800. qrzX.&?
  8801. ,&"X`xx
  8802. pTMM=
  8803. .*!/mi{m%5>
  8804. x$=.=====
  8805. --0--0
  8806.     }yvty
  8807. :9<<<
  8808. dn^$5
  8809. :::::
  8810. ?"PWIX*3
  8811. {``r->>,8
  8812. u[HM+]666k
  8813. .*3*mi{T
  8814. =''&hrr
  8815. lrX\44
  8816.  &^``x
  8817. ss\r--
  8818. 12!$E[HM
  8819. *20&gi]
  8820. 66666
  8821. ;;;;;
  8822. 46644
  8823. yyyrr
  8824.                         
  8825. ::::::
  8826. ;;;;;;;;
  8827. qXh+$
  8828. bcgD"cw
  8829. 272727
  8830.     BD]K
  8831. 0<%0*`
  8832. dbdT,84
  8833. c^MC=
  8834. 6666+n
  8835.     BD]K
  8836. {hh`"664
  8837. iwYM2=666
  8838. 66</Jn
  8839. 8Ao}r
  8840. ;;;;;;;;;;;;;;
  8841. ;;;;;;;
  8842. -<--<
  8843. ;;;;;;
  8844. ;;;;;;;;
  8845. ;;;;;
  8846. qtqttv
  8847. ;;;;;;;;
  8848. ;;;;;;;
  8849. ;;;;;;;;;
  8850. ;;;;;;;
  8851.     opl]2
  8852.                     
  8853. |tttt
  8854. :::9:9::
  8855. ^)m))^)5
  8856. ;;;;;;;;;;
  8857. ;;;;;
  8858. ;;;;;;;;;
  8859. 41242
  8860. "*"qt
  8861. 4p44P4
  8862. ;;;;;;;;;;;;;
  8863. ;;;;;;;;
  8864. tyyvt
  8865. sbyZh
  8866. ;;;;;;;;;;;;;;;;;;;;;;;;;
  8867. ;;;;;
  8868. ;;;;;;;;
  8869. >>>46
  8870. 13??-
  8871. v{y{yv
  8872. ;;;;;;;
  8873. ;;;;;;;;;;;;;;;;;;
  8874. ;;;;;;;;;;;
  8875. >;442
  8876. 80"""bbn
  8877. ;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
  8878. ;;;;;;;;;;
  8879. +js%))
  8880. ;;;;;;;;
  8881. qqttqq
  8882. w}rh##>$
  8883. "&,_uzp
  8884. f777Q
  8885. F=77q
  8886. ;6666
  8887. 4AJUk/;
  8888. 2_gur
  8889. ;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
  8890. ;;;;;;;;;
  8891. ;;;;;;;;;;;;
  8892. ;;;;;;
  8893. ;;;;;;;;;;
  8894. ;;;;;;;
  8895. Uy=yU
  8896. 1."1"
  8897. ;;;;;;;
  8898. ;;;;;;;;
  8899. ;;;;;;;;;;;
  8900. ;;;;;;5x
  8901. ((4421
  8902. ;;;;;;
  8903. ;;;;;;
  8904. ;;;;;
  8905. (((224
  8906. |tttt
  8907. ;$Akk
  8908. ((((7
  8909.     rrrq
  8910. *--0-**0-"".
  8911. vk|h .%?
  8912. 8;3080
  8913. "66!    
  8914. 6669!!+?
  8915. 9+=%=<9#
  8916. ;5=<0
  8917. ((731
  8918.     pp~p
  8919. ;;;;;
  8920. ;;;;;
  8921. ;;;;;;
  8922. ;;;;;;
  8923. qqwrr
  8924. ;;;;;;
  8925. ;;;;;;
  8926. ~~~~p~~~
  8927. qttts-
  8928. uoq~z
  8929. rrlvw
  8930. nvy{p
  8931. rlrry
  8932. 8;;30
  8933. rlvvr
  8934. plyyvl{
  8935. yyrrr
  8936. 7;38>8;;
  8937. ~~~~~~
  8938. ;;;;;
  8939. ~~~~~~p~~~p~p~
  8940. %4%80"**8%800)
  8941. <001=
  8942. ~~~~~~~~~p~
  8943. >6>44
  8944. 14336
  8945. vrh}jl
  8946. ---*s
  8947. *hhzd
  8948. "oquz
  8949. 6666!+4A
  8950. 23ZZh
  8951. 1"9"1"
  8952. ~~~~~
  8953. tnt}y
  8954. 63633
  8955. vvvtl
  8956. rnhtqtnll
  8957. 6777(
  8958. 63364336
  8959. trxhuutq
  8960.             yl
  8961. 33333
  8962. 6334664
  8963. 36366
  8964. 6433>4443643
  8965. 8:6:6
  8966. 11<'01='1
  8967. 63131613
  8968. qqtqs
  8969. 11<'=
  8970. 34631
  8971. 7777772
  8972. 77772
  8973. 6;3363
  8974. ;6'3;
  8975. ;8;83;
  8976. 4363>6
  8977. 8888;
  8978. 8888;8
  8979. 6383;
  8980. 113336
  8981. 33383;
  8982. 81                1
  8983. 8818888;
  8984. ----<
  8985. 4%84+
  8986. 1?3313
  8987.     1ZZSmyooi
  8988. v+6666
  8989. 666"+.2&
  8990. bSSR6
  8991. 22227
  8992. 77-2227(
  8993. 6!!!!6
  8994. qttqs
  8995. sqqtt
  8996. 03;86
  8997. =11<<30
  8998. <<<<=<
  8999. ---0--
  9000. tvytl
  9001. :GMG:
  9002. RR8jc
  9003. y">iJCH
  9004. dqu    qaC
  9005. &ccmT;;(
  9006. 11;<1
  9007. ;3(_llr
  9008. rrhh-
  9009. yv{rp
  9010. D]]]y
  9011. 7762626
  9012. 66:26
  9013. g9RRRRg
  9014. 7,=7<
  9015. 1<1=<
  9016. >333<<
  9017. 3*8'*
  9018. <111?
  9019. (-772(77
  9020. 5555375
  9021. 9^m^i,8,<,',8
  9022. 9999@
  9023. &lp[K
  9024. n\V..
  9025.     U777b
  9026. hwmT5/
  9027. 1rXr^'*',0*'';*,
  9028. T[pf&)2
  9029. y777N
  9030. &cuhT;
  9031. 05585
  9032. 5''17
  9033. "**713
  9034. 5,<0*'
  9035. 0000=0
  9036. 2&V??
  9037. 11111
  9038. !UvaL?!]66
  9039. f777Q
  9040. cuhT$
  9041. iPi9i9
  9042. ^^^9P
  9043. #6 PxYM=!$6]6
  9044. cifT;5
  9045. 9P9i9PP999
  9046. =13($
  9047. ''66fBYY=
  9048. QmiZ$5
  9049. 'rii[
  9050. 66/..6/6
  9051. cihT1
  9052. -a|i[
  9053. ciTT;
  9054. 22\Ykk
  9055. 999P99
  9056. oAUeT;2eez9^g
  9057. &cgfT$
  9058. 9PPPi
  9059. +*Z*++
  9060. ^oy|>
  9061. @,0?i
  9062. /1Tfkg
  9063. !cqhc$5-
  9064. iPiPi
  9065. 00000007
  9066. GGMtGx
  9067. 7r@@7
  9068. 1>o1pkTA;
  9069. &fu[K
  9070. K\ix1?>9^
  9071. XYX^XYXY^
  9072. AAAAA^ANQNQXQXXXXXXXXXXXX
  9073. GXGGXGGXGXGXGXGXXXXXXXXXXXXNXN
  9074. ;Gfkc
  9075. 999BG[(
  9076. V&AAi
  9077. ckTT;
  9078. XG||$$
  9079. A$$2=
  9080. vvwvv
  9081. AMjV?
  9082. XY^^XY_Y^
  9083. XXXXXXX
  9084. %$Tfj
  9085. jf$$%-
  9086. XA||$=
  9087. A$$2=
  9088. 9P99999
  9089. XXXXX
  9090. XXXXXX
  9091. XXXXX
  9092. 9PPiiii
  9093. Y^^^^Y_Y^^
  9094. Q<<<<GX
  9095. XXXXX
  9096. Y^^^^^^^^
  9097. YXYXYXYX=
  9098. YXYXYXY
  9099. YYYYYYYYY
  9100. gPgS|X
  9101. XXXXX
  9102. SSSSSSSSS
  9103. IHIHIHIH
  9104. IHIHIHI
  9105. IIIIIIIIIY
  9106. Afrfr
  9107. XXXXX
  9108. XIXI-==
  9109. -I-dY
  9110. x2%(XQ
  9111. s(cP(P
  9112. )!"--
  9113. dd=d===
  9114. 33,3,331
  9115. +2>>>=
  9116. za=XXX
  9117. s(c>P(c
  9118. ppppp
  9119. dd=dd==
  9120. XXXXX
  9121. 1Gfkc
  9122. ckhG$
  9123. -/d/---/-d-H
  9124. XXAA$|==
  9125. ?9#99
  9126. >EfXfZf
  9127. (ZZZQ
  9128. yyyZ##
  9129. ZZZyyZyZ#
  9130. EZXQEEXZEfXEEf
  9131. XA|$$=
  9132. ?5,&@AH
  9133. SSP+S
  9134. 6?23    
  9135. Iyr@|w
  9136. twrtrr
  9137. {{pppppp
  9138. -ggUO^O^O^o^o^Vgggg
  9139. XIXII
  9140. IXIXIX==
  9141. $>$>AXXXAN
  9142. GQyQG
  9143. =ge==eeXdeeedeeeed
  9144. XA|$$=
  9145. ?55-~J
  9146. ========
  9147. ========
  9148. Y^^^==
  9149. =?deX
  9150. XXXXXXX
  9151. ptpp{{{
  9152. (2272
  9153. 22777
  9154. Y:Y:YXY
  9155. Y^^^^^^XX
  9156. Y^^^^^^YX
  9157. XXXXXXXX
  9158. 41114
  9159. k}HS-2
  9160. XXXXXX
  9161. $)$ $
  9162. vvye666
  9163. r\\Z(
  9164. 06cS_
  9165. ========
  9166. <kmrA
  9167. >99::
  9168. tZ(((
  9169. ^iij7
  9170. aWW]:
  9171. _XXXX
  9172. nthh?
  9173. Psuu%
  9174. uupW"K'
  9175. _]vUNXX
  9176. ====    
  9177. 5'W[apuuph
  9178.   +    +/"
  9179. pv|ly{{j
  9180. -"7$mpT
  9181. _Y_YXXXY
  9182.     !fmO
  9183. DOP)&
  9184. penR%.
  9185. PPsu%%
  9186. 2'[[ep
  9187. 38+:**(+
  9188. +$fFN
  9189. uuupa
  9190. uufuuu
  9191. ufufffuu
  9192. gYiX0
  9193. 6::3            
  9194. :2$[aep
  9195. uuuuuuuu
  9196. pea+'25
  9197. "&(oT
  9198. ~~~~.8
  9199. e\ZT*
  9200. a`aT8p
  9201. '07$frR
  9202. Q[e#7
  9203. t\(R&
  9204. w|rryrr
  9205. 6:43    
  9206. uuppu
  9207.     ++>:
  9208. ylrrlll
  9209. 2+$rFN
  9210. uuuph.W'<
  9211. 4=;/|nzn
  9212. *-";;;(1
  9213. CB||#
  9214. rh#\&<
  9215. #!&^sss
  9216. 3U^~~
  9217. xV@F8
  9218. u~u8.[
  9219. 8[%xx
  9220. :63>    :    
  9221. 6?<2::>3
  9222. aehhhae
  9223. p[[.[a[['
  9224. 5'..&$J_
  9225. 1;"1@zc
  9226. ph[W">>H; 
  9227. ''9&&//Zkkuu
  9228. ::-<$5-
  9229. :<-:55-
  9230. `|}|b
  9231. W^ZTTB
  9232. 11118
  9233. ytaazjl
  9234. `-X"U
  9235. /&*TX**6
  9236. 628'?
  9237. +$lFN
  9238. }}}f<;<8' 5!
  9239. '55&d}na
  9240. #888883"4
  9241. 88*\ll
  9242. hgna&.
  9243.     1    188
  9244. rg&&&?
  9245. 363        
  9246. -02+mrFD
  9247. p[WW+
  9248. "_vtr
  9249.     r{jt
  9250. -?*)-
  9251. jLo]7
  9252. **;85);
  9253. <T-\l
  9254. :33:    
  9255. {yntv}
  9256. aWKK6
  9257. ll}zqq}z
  9258. qqqqqrrr
  9259. iV!,?
  9260. --*---<0
  9261. (ZW}g
  9262. vW--v
  9263. v*vvE
  9264. lcdxr
  9265. x{xuuqn*88"T^l^*
  9266. vvvqs
  9267. 2hllh
  9268. 000-0<-
  9269. <"00-
  9270. alltl
  9271. $&.)&
  9272. 2+&tA_C
  9273. >TP|n
  9274. llhX8
  9275. 4S^Wn
  9276. 8))0$
  9277. lyrn#
  9278. :::46:<4
  9279. 22+mJAH
  9280. ::::::::
  9281. !GPjn
  9282. pFvbn(
  9283. p{hh|
  9284. #SZhw
  9285. 22:266666(866(626
  9286. {trrr
  9287. ((XZ#(!
  9288. yrvyvv
  9289. tyt{y
  9290. }tr(Z(
  9291. WT-Z&(
  9292. 8"""-*8,
  9293. r0%.Z
  9294. hhlhr
  9295. <6242
  9296. rll((
  9297. h(6#v"
  9298. 04604848&8^siilfdvl
  9299. (n(22
  9300. hl*8X
  9301. 22666222
  9302. l62266
  9303. "S",`hhdX
  9304. 4<)65
  9305. &6*634
  9306. 99989
  9307. 66lvt
  9308. 995<<<
  9309. 86:4644+
  9310. rvvnnnvlX
  9311. 666666
  9312. :::9999
  9313. 3044?
  9314. 99999
  9315. 6222(72
  9316. 22((r
  9317. lnrlllv
  9318. 8VPZb
  9319. hlpP"
  9320. 8<99>
  9321. =rllh(66
  9322. rlllva
  9323. aa^Z66
  9324. duwtr
  9325. 9<:999
  9326. 4%66666422
  9327. 6ng[g
  9328. RXZ,688
  9329. 6ZdZ6,6(PPXZ
  9330. 6(llnrlr
  9331. !~~ -
  9332. z`hbhZ
  9333. ,888dXb0
  9334. <60488
  9335. nnvnl
  9336. vrvlh#
  9337. qntntn
  9338. vtttn
  9339. >::3    
  9340. 66:(86
  9341. 2226(2
  9342. ::    ybhZdl#((
  9343. nnttvq
  9344. j#(-46(((666
  9345. 666226
  9346. tvrh6(22
  9347. qqvqx
  9348. qsn0%8%4
  9349. nrthv
  9350. ,,6^z
  9351. 666266
  9352. (622222
  9353. :9:::
  9354. 22222
  9355. vuq}t
  9356. 0884%
  9357.     qqttqq
  9358. ryryr
  9359. rl626
  9360. 00-*n
  9361. sttttr
  9362. hqh~vkhq}vl
  9363. lyrll6
  9364. rrr(((lhlhhl
  9365. #llly
  9366. L:<::
  9367.     3;9:
  9368. kj~x}|
  9369. lanry
  9370. `PPP0
  9371. vtttt
  9372. vhntvhnn
  9373. 6lrll
  9374. rrrllh.6
  9375. 06ldhb
  9376. lflllbrl
  9377. rrlrr
  9378. rrrh-
  9379. lrrrl
  9380. 00084
  9381. 8880n*<
  9382. ,lrhh
  9383. rrrrlr
  9384. %8%0"^skqnnsvnh
  9385. vk*8%8%%4
  9386. rrlhx
  9387. 8data
  9388. 5TAIL
  9389. )data
  9390. UASAUUUUUASUUOAUUAAUUUASAASAUUUUUUAAUUAUAGAUUUUUUSAAUASUUGUAUGAGAAGASAUGU@OAAGAGASAG@SAAAGU@UAUGAS@@GG@AA
  9391. UUUGUAUUUUUUUUUU@UAGAGSUASAAGUSUAAUSAUSAUGSASAASUOAGUGUUUAUGASGAUAUSAUAUUAGU@OASGAUAAGUUAGAGGSAGGASA@U@S@
  9392. XXUOAAUOUUAUAASUUUAUUUAASAGUOAGSASAGAAUAAGAAUGAGAAGASAGAAGAUAAGUAAGSAAAG@AG@AAUAU@AAGAG@AG@A@@AG@@@@@AGAG
  9393. iXUAUUAUOUUOUUAUUOGAGASAUUAAAAAAUAGOAAAAGO@AAAGAUAUSAAAUAAAUAGOAGAAGAAA@AGAAAGAG@GAGAA@AGA@AGAU@G@@@AG@@A
  9394. tkXUUAUAGAUAAAUAAAUAASAUAAUUUUASAGOUUUAUAUAAUAASOAGAUAUAASAGUAUOAAUAUAGAG@SSAGOAGASAUG@AAG@GAAU@@@G@@@GOA
  9395. kXUOUOUUGSGUAAAUSAGUAUAAAOOUOUOUUUUUKXXUUUUUUUUUUOUUUUUUUUUAUUXUUAUUUOUUUAUUUAUUAUUUUAUUUAUAUUUUUUAUUAASASUAUAAUAAAUAAGA@A
  9396. ====^
  9397. XYXY^^
  9398. 1XXXXUA@
  9399. XYXYXX^YXY
  9400. kkXU>*
  9401. Y^^^^^Y_Y^^
  9402. Y^^^^^^
  9403. XY_Y_
  9404. I-d===
  9405. P:1$$$
  9406. Y---d
  9407. 444Auuu
  9408. aWW]:
  9409. uupW>W$
  9410. _YYXY
  9411. \p[)p)p)[\\\:)\606:<<<<06:\:\\:\\:\\:\::6:\:\0:6:6:06:6:
  9412. u~duu
  9413. +;&Z|pO:
  9414. Q[e#12
  9415. !-3=]]]]s|||||s|]|||||||||
  9416. |]]s|
  9417. s||||
  9418. zs__93###
  9419.  #$"  $
  9420. -333333FFFFF3FF3FFFFFWWFWWF9FWWWWFWWFWWWWWWbbbbbbs|
  9421. ||zzsszsWFFFWFWbzzz|bszz||
  9422. z_d_B9&#
  9423.    #"  $.
  9424. ('('---(((-('('---3933933-399933333-393999999DDD_x
  9425. xg__MFDDDD9339999DD_DD99D__d___ggxxgxxxd_MMB;0###    
  9426.   ).1
  9427. "_vtr
  9428.     r{jr
  9429. #"((#
  9430. &(((&&&00JJMJ;;000&((0&(&&0(0&000000;;;020000;;;;JJJJ8;888.)&$&$.11115<<
  9431. >9??9
  9432. :99:9:
  9433. "TAIL
  9434. +data
  9435. UASAUUUUUASUUOAUUAAUUUASAASAUUUUUUAAUUAUAGAUUUUUUSAAUASUUGUAUGAGAAGASAUGU@OAAGAGASGAGSAAAGU@UAUGA
  9436. UUUGUAUUUUUUUUUU@UAGAGSUASAAGUSUAAUSAUSAUGSASAASUOAGUGUUUAUGASGAUAUSAUAUUAGU@OASGAUGAGUUAGAGGSAGG
  9437. XXUOAAUOUUAUAASUUUAUUUAASAGUOAGSASAGAAUAAGAAUGAGAAGASAGAAGAUAAGUAAGSAAAG@AG@AAUAU@AGAAG@AG@A@@AG@
  9438. iXUAUUAUOUUOUUAUUOGAGASAUUAAAAAAUAGOAAAAGO@AAAGAUAUSAAAUAAAUAGOAGAAGAAA@AGAAAGAG@GAAGA@AGA@AGAU@G
  9439. tkXUUAUAGAUAAAUAAAUAASAUAAUUUUASAGOUUUAUAUAAUAASOAGAUAUAASAGUAUOAAUAUAGAG@SSAGOAGASAUG@AAG@GAAU@@
  9440. kXUOUOUUGSGUAAAUSAGUAUAAAOOUOUOUUUUUKXXUUUUUUUUUUOUUUUUUUUUAUUXUUAUUUOUUUAUUUAUUAUUUUAUUUAUAUUUUUUAUUAASASUAUAAUAAAUAAGA@A@
  9441. XYXY^^
  9442. XYXYXX^YXY
  9443. kkXU>*
  9444. Y^^^^^Y_Y^^
  9445. Y^^^^^^
  9446. XY_Y_
  9447. kKA@@A
  9448. @A@A@@@A@A@AX
  9449. ^^^XYYXY
  9450. ^^^YXXYX
  9451. Y^^YXXYX
  9452. Y^Y^^^^^
  9453. a8?52,y
  9454. XXYXYXY
  9455. XYX^XYXXY
  9456. uupW>W$
  9457. _YYXY
  9458. \p[)p)p[\\)\\\6:606:<<<06:\:\\:\\:\\:\::6:\:\0:6:6:06:60:
  9459. uuuujf
  9460. +;&Z|pO:
  9461. Q[e#12
  9462. !(-=F]]]]s|||||s|]|||||||||
  9463. |]]s|
  9464. s||||
  9465. zs__93###
  9466.  #$"  $
  9467. --33333FFFFF3FF3FFFFFWWFWWF9FWWWWFWWFWWWWWWbbbbbbs|
  9468. ||zzsszsWFFFWFWbzzz|bszz||
  9469. z_d_B9&#
  9470.    #"  $.
  9471. ('('---(((-('('---3933933-399933333-393999999DDD_x
  9472. xg__MFDDDD9339999DD_DD99D__d___ggxxgxxxg_MMB;0###    
  9473.   ).1
  9474. "_vtr
  9475.     r{jr
  9476. #"((#
  9477. &(((&&&00JJMJ;;000&((0&(&&0(0&000000;;;020000;;;;JJJJ;8888.)&$&$.11115<<
  9478. >9??9
  9479. -data
  9480. UAUUUUUASUUOAUUAAUUUASAASAUUUUUUAAUUAUAGAUUUUUUSAAUASUUGUAUGAGAAGASAUGU@OAAGAGASGAGSAAAGU@UAUGAS@@GG@AA
  9481. UGUAUUUUUUUUUU@UAGAGSUASAAGUSUAAUSAUSAUGSASAASUOAGUGUUUAUGASGAUAUSAUAUUAGU@OASGAUGAGUUAGAGGSAGG@SA@U@S@
  9482. OUOUUUUUAUUUUUUUUAUUASAGUAGGA@GUAUAGAUOUAASAUSASAUG@SASOASUAGAGSAUGOUSUUAUAGGAS@AGAUAAGGA@@AGUAGGGGAGAG
  9483. UOAAUOUUAUAASUUUAUUUAASAGUOAGSASAGAAUAAGAAUGAGAAGASAGAAGAUAAGUAAGSAAAG@AG@AAUAU@AGAAG@AG@A@@AG@@@@@AGGA
  9484. UAUUAUOUUOUUAUUOGAGASAUUAAAAAAUAGOAAAAGO@AAAGAUAUSAAAUAAAUAGOAGAAGAAA@AGAAAGAG@GAAGA@AGA@AGAU@GAG@AG@@A
  9485. XUUAUAGAUAAAUAAAUAASAUAAUUUUASAGOUUUAUAUAAUAASOAGAUAUAASAGUAUOAAUAUAGAG@SSAGOAGASAUG@AAG@GAAU@@G@G@@GOA
  9486. XUOUOUUGSGUAAAUSAGUAUAAAOOUOUOUUUUUKXXUUUUUUUUUUOUUUUUUUUUAUUXUUAUUUOUUUAUUUAUUAUUUUAUUUAUAUUUUUUAUUAAS
  9487.     XXUA
  9488. XYXY^^
  9489. XYXYXX^YXY
  9490. Y^^^^^Y_Y^^
  9491. Y^^^^^^
  9492. XY_Y_
  9493. -d=dX
  9494. d---d---
  9495. --d---
  9496. 76\B_
  9497. ^Y^^^XY_
  9498. 4AAAu
  9499. aWW]:
  9500. =<:6akU
  9501.       $)
  9502. uupW>W$
  9503. _YYXY
  9504. #A441   
  9505. sF3(##
  9506.   ))$  $
  9507. #11$ 
  9508. (3F]|
  9509. sW9-#
  9510. $&&  $$
  9511. +;&Z|pO:
  9512. Q[e#12
  9513. !-3=]]]]s|||||s|]|||||||||
  9514. |]]s|
  9515. s||||
  9516. zs__93###
  9517.  #$"  $).
  9518. -333333FFFFF3FF3FFFFFWWFWWF9FWWWWFWWFWWWWWWbWbbbbs|
  9519. ||zzsszsWFFFWFWbzzz|bszz||
  9520. z_d_B9&#
  9521.    #"  $.11
  9522. ('('---(((-('('---3933933-399933333-393999999DDD_x
  9523. xg__MFDDDD9339999DD_DD99D__d___ggxxgxxxg_MMB;0###    
  9524.   ).11:
  9525. "_vtr
  9526.     r{jr
  9527. #"((#
  9528. &(((&&&00JJMJ;;000&((0&(&&0(0&000000;;;020000;;;;JJJJ;8888.)&$&$.11115<<::
  9529. >9??9
  9530. # &&)0..122822228<<<<<<<80.........)...2882888821122812588<<<<N<<<<<822212121.1..)))&$&
  9531. :99:9:
  9532.  TAIL
  9533. /data
  9534. UAUUUUUASUUOAUUAAUUUASAASAUUUUUUAAUUAUAGAUUUUUUSAAUASUUGUAUGAGAAGASAUGU@OAAGAGASAG@SAAAGU@UAUGAS@@GG@A
  9535. UGUAUUUUUUUUUU@UAGAGSUASAAGUSUAAUSAUSAUGSASAASUOAGUGUUUAUGASGAUAUSAUAUUAGU@OASGAUAAGUUAGAGGSAGGASA@U@S
  9536. OUOUUUUUAUUUUUUUUAUUASAGUAGGA@GUAUAGAUOUAASAUSASAUG@SASOASUAGAGSAUGOUSUUAUAGGAS@AAGUGAGGA@@AGUAGGGAAGA
  9537. UOAAUOUUAUAASUUUAUUUAASAGUOAGSASAGAAUAAGAAUGAGAAGASAGAAGAUAAGUAAGSAAAG@AG@AAUAU@AAGAG@AG@A@@AG@@@@@AGA
  9538. UAUUAUOUUOUUAUUOGAGASAUUAAAAAAUAGOAAAAGO@AAAGAUAUSAAAUAAAUAGOAGAAGAAA@AGAAAGAG@GAGAA@AGA@AGAU@G@@@AG@@
  9539. XUUAUAGAUAAAUAAAUAASAUAAUUUUASAGOUUUAUAUAAUAASOAGAUAUAASAGUAUOAAUAUAGAG@SSAGOAGASAUG@AAG@GAAU@@@G@@@GO
  9540. XUOUOUUGSGUAAAUSAGUAUAAAOOUOUOUUUUUKXXUUUUUUUUUUOUUUUUUUUUAUUXUUAUUUOUUUAUUUAUUAUUUUAUUUAUAUUUUUUAUUAA
  9541.     XXUA
  9542. XYXY^^
  9543. XYXYXX^YXY
  9544. Y^^^^^Y_Y^^
  9545. Y^^^^^^
  9546. XY_Y_
  9547. kXA@@@6@
  9548. =YXYX=
  9549. YYXYYYXY
  9550. 76\B_
  9551. YXYXYXY
  9552. XYXXY
  9553. Y^^^Y_
  9554. 4AAAu
  9555. aWW]:
  9556. =<6:akE
  9557.       $)
  9558. uupW>W$
  9559. _YYXY
  9560. #A441   
  9561. sF3(##
  9562.   ))$  $
  9563. #11$ 
  9564. (3F]|
  9565. sW9-#
  9566. $&&  $$
  9567. +;&Z|pO:
  9568. Q[e#12
  9569. !-3=]]]]s|||||s|]|||||||||
  9570. |]]s|
  9571. s||||
  9572. zs__93###
  9573.  #$"  $).
  9574. -333333FFFFF3FF3FFFFFWWFWWF9FWWWWFWWFWWWWWWbbbbbbs|
  9575. ||zzsszsWFFFWFWbzzz|bszz||
  9576. z_d_B9&#
  9577.    #"  $.11
  9578. ('('---(((-('('---3933933-399933333-393999999DDD_x
  9579. xg__MFDDDD9339999DD_DD99D__d___ggxxgxxxg_MMB;0###    
  9580.   ).11:
  9581. "_vtr
  9582.     r{jr
  9583. #"((#
  9584. &(((&&&00JJMJ;;000&((0&(&&0(0&000000;;;020000;;;;JJJJ;8888.)&$&$.11115<<::
  9585. >9??9
  9586. # &&)0..122822228<<<<<<<80.........)...2882888821122812588<<<<N<<<<<822212121.1..)))&$&
  9587. :99:9:
  9588. 1data
  9589. OUASAUUUUUASUUOAUUAAUUUASAASAUUUUUUAAUUAUAGAUUUUUUSAAUASUUGUAUGAGAAGASAUGU@OAAGAGASAG@SAAAGU@UAUGAS@@G
  9590. UUUUGUAUUUUUUUUUU@UAGAGSUASAAGUSUAAUSAUSAUGSASAASUOAGUGUUUAUGASGAUAUSAUAUUAGU@OASGAUAAGUUAGAGGSAGGASA@
  9591. iXXUOAAUOUUAUAASUUUAUUUAASAGUOAGSASAGAAUAAGAAUGAGAAGASAGAAGAUAAGUAAGSAAAG@AG@AAUAU@AAGAG@AG@A@@AG@@@@@
  9592. kiXUAUUAUOUUOUUAUUOGAGASAUUAAAAAAUAGOAAAAGO@AAAGAUAUSAAAUAAAUAGOAGAAGAAA@AGAAAGAG@GAGAA@AGA@AGAU@G@@@A
  9593. kkXUUAUAGAUAAAUAAAUAASAUAAUUUUASAGOUUUAUAUAAUAASOAGAUAUAASAGUAUOAAUAUAGAG@SSAGOAGASAUG@AAG@GAAU@@@G@@
  9594. kXUOUOUUGSGUAAAUSAGUAUAAAOOUOUOUUUUUKXXUUUUUUUUUUOUUUUUUUUUAUUXUUAUUUOUUUAUUUAUUAUUUUAUUUAUAUUUUUUAU
  9595. (XXUA
  9596. XYXY^^
  9597. XYXYXX^YXY
  9598. Y^^^^^Y_Y^^
  9599. Y^^^^^^
  9600. XY_Y_
  9601. kKA@@
  9602. ---d---d
  9603. YXYXY
  9604. Y^^^^^YXYX
  9605. Y^^^Y_
  9606. aWW]:
  9607. uupW>W$
  9608. _YYXY
  9609. \p[)p)p[\)\\\:6:606:<<<06:\:\\:\\:\\:\::6:\:\0:6:6:06:66
  9610. AAA11$ 
  9611. (3F]|
  9612. sW9-#
  9613. +;&Z|pO:
  9614. Q[e#12
  9615.     =1/gpnA!
  9616. 8888$.
  9617. ...$$88?
  9618. 8.$.$.....$.
  9619. -333333FFFFF3FF3FFFFFWWFWWF9FWWWWFWWFWWWWWWbbbbbbs|
  9620. ||zzsszsWFFFWFWbzzz|bszz||
  9621. zg_dD0&"
  9622.    #"  $
  9623. ('('---(((-('('---3933933-399933333-393999999DDD_x
  9624. xg__MFDDDD9339999DD_DD99D__d___ggxxgxxxd_MMB;0###    
  9625. "_vtr
  9626.     r{jr
  9627. #"((#
  9628. &(((&&&00JJMJ;;000&((0&(&&0(0&000000;;;020000;;;;JJJJ8;888.)&$&$.11115<
  9629. >9??9
  9630. # &&)0..122822228<<<<<<<80.........)...2882888821122812588<<<<N<<<<<822212121.1..)))
  9631. :99:9:
  9632. $TAIL
  9633. 3data
  9634. AUOUUAUAASUUUAUUUAASAGUOAGSASAGAAUAAGAAUGAGAAGASAGAAGAUAAGUAAGSAAAG@AG@AAUAU@AGAAG@AG@A@@AG@@@@@AG
  9635. UAUOUUOUUAUUOGAGASAUUAAAAAAUAGOAAAAGO@AAAGAUAUSAAAUAAAUAGOAGAAGAAA@AGAAAGAG@GAAGA@AGA@AGAU@G@@@AG@
  9636. AUAGAUAAAUAAAUAASAUAAUUUUASAGOUUUAUAUAAUAASOAGAUAUAASAGUAUOAAUAUAGAG@SSAGOAGASAUG@AAG@GAAU@@@G@@@G
  9637. UOUUGSGUAAAUSAGUAUAAAOOUOUOUUUUUKXXUUUUUUUUUUOUUUUUUUUUAUUXUUAUUUOUUUAUUUAUUAUUUUAUUUAUAUUUUUUAUUA
  9638. XYXY^^
  9639. XYXYXX^YXY
  9640. Y^^^^^Y_Y^^
  9641. Y^^^^^^
  9642. XY_Y_
  9643. YYYYYYY
  9644. YYYYYYYY
  9645. YYXYXY
  9646. YIIIIIII
  9647. IIIIIIII
  9648. IHIHIHI
  9649. IIII-==
  9650. d====
  9651. =d=d====
  9652. kKA@@A@4@@@
  9653. IIIdddI--dIII
  9654. ddYY==
  9655. d=d==
  9656. tI-IIY
  9657. YIIIIII-I==IIIIII-Id==
  9658. YYdddd
  9659. YYYddd
  9660. YX^Xd
  9661. YXYYY
  9662. Y^^^^XYXXY
  9663. Y^^^X
  9664. XY^^Y_
  9665. aWW]:
  9666. _YYXY
  9667. |F3(##
  9668.   ))$  $&&)
  9669. >&SAT
  9670. ~~~~.8
  9671. +;&Z|pO:
  9672. Q[e#12
  9673.     =1/gpnA!
  9674. 88?888$.
  9675. ...$$88?
  9676. 8.$.$.....$.
  9677. -333333FFFFF3FF3FFFFFWWFWWF9FWWWWFWWFWWWWWWbbbbbbs|
  9678. ||zzsszsWFFFWFWbzzz|bszz||
  9679. z_d_B9&#
  9680.    #"  $.1128<
  9681. ('('---(((-('('---3933933-399933333-393999999DDD_x
  9682. xg__MFDDDD9339999DD_DD99D__d___ggxxgxxxg_MMB;0###    
  9683.   ).11:11<
  9684. "_vtr
  9685.     r{jr
  9686. yyyrp
  9687. trrvvvv
  9688. >9??9
  9689.  # &)028882.&&&&&&&#" &&&&)...0100...).0..088888<<528....)1118<<<8858<8811
  9690. <999:
  9691. ORL 83TAIL
  9692. f===8
  9693. WZWZW
  9694. p===f
  9695. ,7,,7,,
  9696. zb"$?$$?$$z
  9697. ~k]]?~
  9698. ,,,,,,,{
  9699. {,v,v{+{v{vv{
  9700. ===;    
  9701. ==4;4==
  9702. bbs B
  9703. bbs B
  9704. bbs B
  9705. WednesdayTAIL
  9706. ThursdayTAIL
  9707. FridayTAIL
  9708. 81 / 65TAIL
  9709. / 56T+TXT
  9710. 77 / 64TAIL
  9711. / 59T+TXT
  9712. 84 / 65TAIL
  9713. / 64T+BiO
  9714. 6VV0V66
  9715. iTV=g
  9716. VT3Ti
  9717. =!=!3!3!!!!!=!3==
  9718. 5']]]
  9719. !+TXT
  9720. As of Tuesday, December 27, 1995 TAIL
  9721. ]+BiO
  9722. !data
  9723. =data
  9724. 4TAIL
  9725. Edata
  9726. ll~l~~LC
  9727. 2/s{*
  9728. ==FH*
  9729. III-III-I-I-I
  9730. ddkdddddddd
  9731. Ydd~Y
  9732. ======d
  9733. d~Y~d
  9734. =5?>?
  9735. Z?>fY
  9736. fZfd|Z|||
  9737. ===d=d=
  9738. =d=~Y'
  9739. =Yd=~YYi
  9740. `%<+@D\??
  9741. |    ;;yr
  9742. !cbc^+3
  9743. <vDb3O?qD@%
  9744. 77777
  9745. 8HFii
  9746. DaaP-]
  9747. qTAIL
  9748. 5data
  9749. UAUUUUUASUUOAUUAAUUUASAASAUUUUUUAAUUAUAGAUUUUUUSAAUASUUGUAUGAGAAGUUAUGU@UOAGAGASAG@SAAAGU@UAUG@OG@GG@AAG@
  9750. OUOUUUUUAUUUUUUUUAUUASAGUAGGA@GUAUAGAUOUAASAUSASAUG@SASOASUAGAGSAUGUUSUUAUAGGAS@AAGUGAGGA@@AGUAGGGAAGAGAG
  9751. UOAAUOUUAUAASUUUAUUUAASAGUOAGSASAGAAUAAGAAUGAGAAGASAGAAGAUAAGUAAGSAAAG@AG@AAUAU@AAGAG@AG@A@@AG@@@@@AGAG@A
  9752. XUUAUAGAUAAAUAAAUAASAUAAUUUUASAGOUUUAUAUAAUAASOAGAUAUAASAGUAUOAAUAUAGAG@SSAGOAGASAUG@AAG@GAAU@@G@G@@GOAG@
  9753. XUOUOUUGSGUAAAUSAGUAUAAAOOUOUOUUUUUKXXUUUUUUUUUUOUUUUUUUUUAUUXUUAUUUOUUUAUUUAUUAUUUUAUUUAUAUUUUUUAUUAASAS
  9754.     XXUA
  9755.     XXUO
  9756. ====^
  9757. XYXY^^
  9758. XYXYXX^YXY
  9759. Y^^^^^Y_Y^^
  9760. Y^^^^^^
  9761. XY_Y_
  9762. YYYYYYYY
  9763. YYYYYYY
  9764. IIIIIIIY
  9765. IIIIIII
  9766. YHIHI
  9767. XIHIHHI
  9768. IIIId=
  9769. IIIeY
  9770. kXA@@@6@
  9771. IIII==
  9772. -IIIY=
  9773. IIIIIII
  9774. IIIIIII
  9775. HII=Y
  9776. Ydddddd=
  9777. =Yddddddd
  9778. YYXY^^^^
  9779. Y^^Y_
  9780. 4AAAu
  9781. aWW]:
  9782.       $)
  9783. uupW>W$
  9784. _YYXY
  9785. #A441   
  9786. |F3(##
  9787.   ))$  $
  9788. #11$ 
  9789. (3F]|
  9790. sW9-#
  9791. $&&  $$
  9792. +;&Z|pO:
  9793. Q[e#12
  9794. !-3=]]]]s|||||s|]|||||||||
  9795. |]]s|
  9796. s||||
  9797. zs__93###
  9798.  #$"  $).
  9799. -333333FFFFF3FF3FFFFFWWFWWF9FWWWWFWWFWWWWWWbWbbbbs|
  9800. ||zzsszsWFFFWFWbzzz|bszz||
  9801. z_d_B9&#
  9802.    #"  $.11
  9803. ('('---(((-('('---3933933-399933333-393999999DDD_x
  9804. xg__MFDDDD9339999DD_DD99D__d___ggxxgxxxg_MMB;0###    
  9805.   ).11:
  9806. "_vtr
  9807.     r{jr
  9808. #"((#
  9809. &(((&&&00JJMJ;;000&((0&(&&0(0&000000;;;020000;;;;JJJJ;8888.)&$&$.11115<<::
  9810. >9??9
  9811. # &&)0..122822228<<<<<<<80.........)...2882888821122812588<<<<N<<<<<822212121.1..)))&$&
  9812. :99:9:
  9813. &data
  9814. :data
  9815. ;data
  9816. Hdata
  9817. d0dxk
  9818. !T!T[!Tdx
  9819. RTk^bk9_^
  9820. Tdddd60
  9821. 59dkP_
  9822. !T0Tw
  9823. 60606kdd9dd
  9824. w!60609
  9825. ZH,U0
  9826. ^0[x!
  9827. |6dk^t
  9828.  UcZbz9
  9829. C[~ Z1Gb
  9830. d9d6k69[C
  9831. R9999
  9832. z9k999C6
  9833. ^_Pu9R6999
  9834. Idata
  9835. Jdata
  9836. c$]c!
  9837. `Iw65
  9838. `wc55
  9839. Ewq5!
  9840. Kdata
  9841. Ldata
  9842. !!wE5
  9843. !!wI`^
  9844. 55cIw
  9845. !55Nk
  9846. ,+BiO
  9847. Pdata
  9848. ,6\\ff
  9849. }hf\fffffff\\P\\f
  9850. 117717
  9851. 171777
  9852. HQHQH
  9853. HQHHQHHQHHQHQHQHQHHHHQHHQHQHQH
  9854. HHHQHHHHQHHHHHHHHQHQHQHQHQHQHQ
  9855. QHHQH
  9856. HQHHHHHQHHHHQHHHHHQHQHHHQHQHQH
  9857. HQHHHHQHQHHQHQHQHQHHHHHQHQHQHQ
  9858. HHHQHHQHHHHHHHQHHHQHQQHHHQHHQH
  9859. (TAIL
  9860. 0INFO
  9861. GreatLakesSCRP
  9862. on openCard
  9863.   global gWCcurrCities
  9864.   global gWCglcities
  9865.   --  global gWCglcitiesInit
  9866.   global gNAVcdev
  9867.   global gWCtomorrow
  9868.   global gWC1dayafter
  9869.   global gWC2daysafter
  9870.   global gWCdate
  9871.   global gWCbtnToCityNav
  9872.   global gWCRegNav
  9873.   global gWCacceptClickDelay
  9874.   global gWCregVoice, gPathAudio, gWCmainmusic
  9875.   initializeCard
  9876.   put empty into gWCglcities
  9877.   put "Chicago ORD 80" into line 1 of gWCglcities
  9878.   put "Cincinnati CVG 29" into line 2 of gWCglcities
  9879.   put "Cleveland CLE 25" into line 3 of gWCglcities
  9880.   put "DesMoines DSM 36" into line 4 of gWCglcities
  9881.   put "Detroit DTW 37" into line 5 of gWCglcities
  9882.   put "Indianapolis IND 56" into line 6 of gWCglcities
  9883.   put "InternationalFalls INL 57" into line 7 of gWCglcities
  9884.   put "LaCrosse LSE 66" into line 8 of gWCglcities
  9885.   put "Marquette MQT 74" into line 9 of gWCglcities
  9886.   put "Minneapolis MSP 75" into line 10 of gWCglcities
  9887.   put gWCglcities into gWCcurrCities
  9888.   putinNewData (the number of this card), gWCcurrCities, 0
  9889.   put empty into gWCbtnToCityNav
  9890.   put "Region DesMoines" into line 1 of gWCbtnToCityNav
  9891.   put "NextDay Indianapolis" into line 2 of gWCbtnToCityNav
  9892.   put "GoBack Cincinnati" into line 3 of gWCbtnToCityNav
  9893.   put "StartOver Cincinnati" into line 4 of gWCbtnToCityNav
  9894.   put "Help Marquette" into line 5 of gWCbtnToCityNav
  9895.   put empty into gWCRegNav
  9896.   put "none" into line 1 of gWCRegNav
  9897.   put "NorthEast" into line 2 of gWCRegNav
  9898.   put "MidAtlantic" into line 3 of gWCRegNav
  9899.   put "none" into line 4 of gWCRegNav
  9900.   if gNAVcdev is "REMOTE" then
  9901.     showInitialLoc
  9902.   end if
  9903.   enableNavBtn
  9904.   --ring bg alarm "alarm_loseClicks" at gWCacceptClickDelay
  9905.   start bg timer "alarm_loseClicks" expire in gWCacceptClickDelay ticks
  9906.   start bg timer open expire in 1 seconds
  9907. end openCard
  9908. CGRPO
  9909. BINFO
  9910. cities_hilitedata
  9911. ;TAIL
  9912. y into gWCReGRPO
  9913. Citiesdata
  9914. "TAIL
  9915.   start GRPO
  9916. AINFO
  9917. GCARD
  9918. Indianapolisdata
  9919. "TAIL
  9920. Cincinnatidata
  9921. @INFO
  9922.     DesMoinesdata
  9923. $TAIL
  9924. ?INFO
  9925.     Clevelanddata
  9926. #TAIL
  9927. >INFO
  9928.     Marquettedata
  9929. &TAIL
  9930. PCARD
  9931. Chicagodata
  9932. Detroitdata
  9933. Minneapolisdata
  9934. <INFO
  9935. InternationalFallsdata
  9936. 'TAIL
  9937. ChicagodaGRPO
  9938. =INFO
  9939. LaCrossedata
  9940. %TAIL
  9941. Detroitda+BiO
  9942. (INFO
  9943. Chicagodata
  9944. k666J
  9945. uuss`
  9946. -S&2-SSF
  9947. ]J_43666
  9948. 4JJx4
  9949. kkkkDkDk
  9950. 66]]]IfIfN
  9951. ]r]]]]<66+3
  9952. 6&&&6
  9953. 6666666666666666
  9954. !!!!9<`
  9955. kkkDkw.6]]
  9956. kkkDkf
  9957. 6]]If]A
  9958. p<]]If]P-
  9959. AA]r]
  9960. AA]r]]<!}}aNa
  9961. AA]r]]<6}}aNaa
  9962. r]<6Na
  9963. -]]<!k
  9964. 3TAIL
  9965. )INFO
  9966. Cincinnatidata
  9967. 'Z#-m
  9968. ~~..8?
  9969. .OSY^
  9970. XkSkk
  9971. >-S}Sa.
  9972. OV%*    $%-
  9973. f>V-#
  9974. {^$$z$|
  9975. ,$z$$z%|
  9976. %z$$z|
  9977. %z$$|
  9978. ~~%.88
  9979. %Q|||-
  9980. },Q||-$
  9981. 66064
  9982. 4<0<>
  9983. u~~kkkI8
  9984. 55555
  9985. !!!-JPk
  9986. P,P^z$z
  9987. sbbWbD
  9988. _bWbW
  9989. $$z$$
  9990. z$$z$"
  9991. 20X O
  9992. $$"$$$
  9993. z%|$$"$
  9994.                             
  9995. -4+++!'A
  9996. +++'++'+-++-++
  9997. '+++++++++444AJ?L___nnqqq
  9998. q___flf
  9999. {__?..g
  10000. $"%$|
  10001. ``+1..
  10002. uu~u~~u~u~
  10003. ~SSauXX
  10004. $#^z_%^
  10005. ;;.;..8.
  10006. *t202O
  10007. %$$%$+
  10008. _%$%$$%
  10009. {%^%$
  10010. 7TAIL
  10011. *INFO
  10012.     Clevelanddata
  10013. .++++.
  10014. +++++g
  10015. RRR!+g
  10016. =PRPRN=XZX
  10017. ^L!!!!?g++++++++++
  10018. L+++4gL
  10019. !!!!N
  10020. ssb_bbbs
  10021. .6&&&6
  10022. '+'Vm
  10023. 44Ade?
  10024. udd_b
  10025. 5555,=
  10026. 55555=
  10027. !AA4q
  10028. ~4.$8
  10029. +INFO
  10030. Detroitdata
  10031. 241J~J/22
  10032. [y544
  10033. WME+b
  10034. !G]WoMWh,
  10035. 444712
  10036. 4444-b}
  10037. 4`n`n/D\2
  10038. 2"g~J~J"
  10039. qq\\\\
  10040. *)UQW
  10041. )??]]]
  10042. 4kblW/
  10043. ZL\H***
  10044. ^O121
  10045. \O141
  10046. \O144
  10047. bqO144
  10048. Ftww<
  10049. f777Q
  10050. Uy7yUz
  10051. ...*>1
  10052. 9.+..=3===
  10053. -...3$
  10054. gggLLX
  10055. 77**='
  10056. !TAIL
  10057. ,INFO
  10058. Indianapolisdata
  10059. 666k<66k
  10060. k"6<r(
  10061. Al]66wk
  10062. f"66v"6
  10063. A]66wk
  10064. k%6<a%6
  10065. (66666(
  10066. ICd-#k
  10067. 4TAIL
  10068. -INFO
  10069. InternationalFallsdata
  10070.         4=^4r
  10071. j{gvjv
  10072. zwwwzgzgw
  10073. vvvvvvvv6
  10074. ldldwwww
  10075. zvvvv
  10076. dttod
  10077. ::9::996
  10078. ]</IQF_
  10079. \\\.<6
  10080. r<!QFFQ
  10081. ]<6A]<6
  10082. ~~uvs
  10083. /aDa]<6*>>C(}
  10084. 8<<<N
  10085. 666/CC0Zs}s}
  10086. ,/66.
  10087. $/0C0
  10088. AAPAJA
  10089. 3A!kRkR
  10090. `!!!>
  10091. !!!!k
  10092. !!!!k`!k
  10093. NSZZZ
  10094. <$e]]
  10095. rd!'!4
  10096. J!!!A
  10097. JJJJJJ^
  10098. r-'--r
  10099. J!!!-_F
  10100. ''yUwP
  10101. D333w
  10102. F333u
  10103. J:<66
  10104. F333u
  10105. &d^Oin
  10106. ]<66k
  10107.     &dziiu
  10108. ,TAIL
  10109. /INFO
  10110.     DesMoinesdata
  10111. 6666666<]<Jk
  10112. ]6]]666
  10113. ]]]]]]]]]P]A
  10114. !!!!!!!!'
  10115. 86666
  10116. +++!!JJJA4A!!!!
  10117. ].8.w
  10118. 555&5
  10119. bWWW5
  10120. 55$$5
  10121. e]66!
  10122. ?5555
  10123. 555?5
  10124. ?5555?55
  10125. 5$555
  10126. 555$$nY
  10127. =TAIL
  10128. 0INFO
  10129.     Marquettedata
  10130. ~/..r@@Fb
  10131. $<9-22
  10132. ./C.2J@@r
  10133. /.,nF@C
  10134. ./.w@@@
  10135. ././F@@@<
  10136. 69&9.99
  10137. 5777++
  10138. +++++
  10139. 2gjbd
  10140. EXjEEEE
  10141. ""TG\
  10142. llolrEvCtF@Fm"_"""_m@
  10143. -r]+a
  10144. %%+%%
  10145. __+,/,2
  10146. !8%2%
  10147. k!66]6'+
  10148. !LLL@+--
  10149. r]]}Dkk
  10150. 2?++++&
  10151. kw<]A!
  10152. 2:000
  10153. k6]]]A
  10154. kkk}.]A
  10155. 0TAIL
  10156. 1INFO
  10157. Minneapolisdata
  10158. +++v<66k
  10159. 577757755777
  10160. 5$55$5
  10161.                             
  10162. S+'+'SI+'++'O
  10163. qy7yqU
  10164.                     
  10165. ddr/$&6k0&
  10166. <66k$6
  10167. szssszszsszs|szszsszszszszs|zzz|z|zz|z|zzzzzzszzz|
  10168. .INFO
  10169. LaCrossedata
  10170. kf(6]}"66
  10171. ...${
  10172. kkkkkkkk
  10173. f<6]]IIIII]-
  10174. rIr7r]r7
  10175. 6]A<66w
  10176. r]r]r]]]]]]]]$
  10177. /aNaNaaaaaaak
  10178. 66666666("66&6"..
  10179. .6&&&6
  10180. 666666
  10181. "&&&6.
  10182. 6&&&6
  10183. "66&6"
  10184. (66&6"
  10185. k!66]J<66k
  10186.     TAIL
  10187. 2INFO
  10188. Chicago_hilitedata
  10189. k666D
  10190. ...|666k
  10191. w.6]]If
  10192. AA]r]]<
  10193. }}aNaa
  10194. l<66w
  10195. 8TAIL
  10196. 3INFO
  10197. Cincinnati_hilitedata
  10198. 8-S}Sa.
  10199. f0X#X
  10200. ^,,`{
  10201. ,,,.,,^
  10202. ]//cl
  10203. ///-</]
  10204. ssssbssb
  10205. 80606
  10206.                     
  10207.     zzzs
  10208. ~SSau-X
  10209. ~~~~v
  10210. ;;;;.;..8.
  10211. *t202t
  10212. .TAIL
  10213. 4INFO
  10214. Cleveland_hilitedata
  10215. zxzsss
  10216. }444214444,hAF
  10217. /hADl
  10218. ~1114
  10219. EIA]-/////9
  10220. RRR!AB
  10221. !r^+++++....+
  10222. ^..+2
  10223. qO///;
  10224. `,//;
  10225. //6;A//
  10226. //-c]/
  10227. !'44`m~~%.$8
  10228. ~%?8?
  10229. 5INFO
  10230. DesMoines_hilitedata
  10231. 0$$$$$
  10232. $$$$$
  10233. $$$$$
  10234. kkkkkk
  10235. ]]]]]]
  10236. ^`^`E
  10237. !JJJA4
  10238. J,EJIJN6
  10239. Wbbs$5
  10240. ]66!k
  10241. WWWW5$
  10242. J4<66
  10243. 5555$$nO
  10244. 5?55$
  10245. ETAIL
  10246. 6INFO
  10247. Detroit_hilitedata
  10248. q-224
  10249. b}21-
  10250. 22.JxJ-2214S
  10251. [y/14
  10252. \621!
  10253. 44448
  10254. >111^
  10255. hREIII
  10256. EE1UE
  10257. Jc]c]c]cI,^BI]]tI]]ve]c]Jc]c]c]]
  10258. c/8=/]]//////]L]/88rp
  10259. 7INFO
  10260. Indianapolis_hilitedata
  10261. //]c//
  10262. //;/]
  10263. //OG6]c
  10264. c]]c]]c]]cI]c
  10265. ..1-___
  10266. k!66]0!+!
  10267. 7TAIL
  10268. 8INFO
  10269. InternationalFalls_hilitedata
  10270.             =/4^
  10271. yaalb
  10272. gw{ggvvvvv
  10273. gvvvv
  10274. dlwdlg
  10275. gvvvvvvvv
  10276. ]</IQF_
  10277. SZ\Z    
  10278. AAAJAJ
  10279. '$$$$$'
  10280. '$%%/&$$$;>
  10281. A!kRkR
  10282. !!!!k
  10283. !!!!S`!k
  10284. rr!-!A
  10285. J!!!A
  10286. JJJJJJr
  10287. --'-d
  10288. '$$$$
  10289. .TAIL
  10290. 9INFO
  10291. LaCrosse_hilitedata
  10292. 5+BiO
  10293. :INFO
  10294. Marquette_hilitedata
  10295. ,F@@l
  10296. ^`^`^^^`
  10297. r]]Ar^
  10298. ;/////]//8;/]DI///8]]//;;]]/;;/]J^
  10299. `^{`>
  10300. `>^rLr,rrr,
  10301. `^^`^
  10302. ,,,,^^
  10303. ^^^^^^^p
  10304. waN<6^
  10305. k%<?^
  10306. 0033R///
  10307. <]<k}]</V
  10308. +++8]<6
  10309. k666]++..
  10310. 000<<
  10311. 0TAIL
  10312. ;INFO
  10313. Minneapolis_hilitedata
  10314. a^^^?
  10315. ~uuu~uu
  10316. a^^^^^
  10317. ddzdzdddddd
  10318. 577757755777
  10319. bWWW5
  10320. S+A+A-
  10321. ++A++
  10322. '2$$$$0
  10323. ||||||
  10324.                         
  10325.                         
  10326. (TAIL
  10327. InternationalFalls_icondata
  10328. Minneapolis_icondata
  10329. LaCrosse_icondata
  10330. Chicago_icondata
  10331. ]+BiO
  10332. DesMoines_icondata
  10333. Indianapolis_icondata
  10334. ]+BiO
  10335. Cincinnati_icondata
  10336. 6VV0V66
  10337. iTV=g
  10338. VT3Ti
  10339. =!=!3!3!!!!!=!3==
  10340. L+BiO
  10341. Cleveland_icondata
  10342. 6VV0V66
  10343. iTV=g
  10344. VT3Ti
  10345. =!=!3!3!!!!!=!3==
  10346. Detroit_icondata
  10347. Marquette_icondata
  10348.  INFO
  10349. InternationalFallsdata
  10350. 46/30ADDD
  10351. Minneapolisdata
  10352. 51/32ADDD
  10353. LaCrossedata
  10354. 54/28ADDD
  10355. Chicagodata
  10356. 55/31ADDD
  10357.     DesMoinesdata
  10358. 55/35ADDD
  10359.     Marquettedata
  10360. 46/26ADDD
  10361.     INFO
  10362. Detroitdata
  10363. 52/29ADDD
  10364.     Clevelanddata
  10365. 54/30ADDD
  10366. Cincinnatidata
  10367. 57/34ADDD
  10368. na+TXT
  10369. Indianapolisdata
  10370. 56/31ADDD
  10371. 'INFO
  10372. InternationalFallsSCRP
  10373. on mouseUp
  10374.   cityButtonPush (the short name of me)
  10375. end mouseUp
  10376. -------------------------
  10377. on mouseDown
  10378.   cityButtonDown (the short name of me)
  10379. end mouseDown
  10380. -------------------------
  10381. on mouseLeave
  10382.   cityButtonLeave (the short name of me)
  10383. end mouseLeave
  10384. citycode
  10385. downcity
  10386. Minneapolis
  10387. leftcity
  10388.     rightcity    Marquette
  10389. upcity
  10390. 64/40ADD+BUT
  10391. MinneapolisSCRP
  10392. on mouseUp
  10393.   cityButtonPush (the short name of me)
  10394. end mouseUp
  10395. -------------------------
  10396. on mouseDown
  10397.   cityButtonDown (the short name of me)
  10398. end mouseDown
  10399. -------------------------
  10400. on mouseLeave
  10401.   cityButtonLeave (the short name of me)
  10402. end mouseLeave
  10403. citycode
  10404. downcity
  10405. LaCrosse
  10406. leftcity
  10407.     rightcity    Marquette
  10408. upcity
  10409. InternationalFallsTAIL
  10410. %INFO
  10411. LaCrosseSCRP
  10412. on mouseUp
  10413.   cityButtonPush (the short name of me)
  10414. end mouseUp
  10415. -------------------------
  10416. on mouseDown
  10417.   cityButtonDown (the short name of me)
  10418. end mouseDown
  10419. -------------------------
  10420. on mouseLeave
  10421.   cityButtonLeave (the short name of me)
  10422. end mouseLeave
  10423. citycode
  10424. downcity    DesMoines
  10425. leftcity
  10426.     rightcity
  10427. Chicago
  10428. upcity
  10429. MinneapolisTAIL
  10430. ChicagoSCRP
  10431. on mouseUp
  10432.   cityButtonPush (the short name of me)
  10433. end mouseUp
  10434. -------------------------
  10435. on mouseDown
  10436.   cityButtonDown (the short name of me)
  10437. end mouseDown
  10438. -------------------------
  10439. on mouseLeave
  10440.   cityButtonLeave (the short name of me)
  10441. end mouseLeave
  10442. citycode
  10443. downcity
  10444. Indianapolis
  10445. leftcity
  10446. LaCrosse    rightcity
  10447. Detroit
  10448. upcity    MarquetteTAIL
  10449. &INFO
  10450.     MarquetteSCRP
  10451. on mouseUp
  10452.   cityButtonPush (the short name of me)
  10453. end mouseUp
  10454. -------------------------
  10455. on mouseDown
  10456.   cityButtonDown (the short name of me)
  10457. end mouseDown
  10458. -------------------------
  10459. on mouseLeave
  10460.   cityButtonLeave (the short name of me)
  10461. end mouseLeave
  10462. citycode
  10463. downcity
  10464. Chicago
  10465. leftcity
  10466. InternationalFalls    rightcity
  10467. Button Help
  10468. upcity
  10469. Button HelpTAIL
  10470. DetroitSCRP
  10471. on mouseUp
  10472.   cityButtonPush (the short name of me)
  10473. end mouseUp
  10474. -------------------------
  10475. on mouseDown
  10476.   cityButtonDown (the short name of me)
  10477. end mouseDown
  10478. -------------------------
  10479. on mouseLeave
  10480.   cityButtonLeave (the short name of me)
  10481. end mouseLeave
  10482. citycode
  10483. downcity    Cleveland
  10484. leftcity
  10485. Chicago    rightcity    Cleveland
  10486. upcity    MarquetteTAIL
  10487.     +BUT
  10488. #INFO
  10489.     ClevelandSCRP
  10490. on mouseUp
  10491.   cityButtonPush (the short name of me)
  10492. end mouseUp
  10493. -------------------------
  10494. on mouseDown
  10495.   cityButtonDown (the short name of me)
  10496. end mouseDown
  10497. -------------------------
  10498. on mouseLeave
  10499.   cityButtonLeave (the short name of me)
  10500. end mouseLeave
  10501. citycode
  10502. downcity
  10503. Cincinnati
  10504. leftcity
  10505. Chicago    rightcity
  10506. Button Help
  10507. upcity
  10508. DetroitTAIL
  10509. agoSCRP+BUT
  10510. CincinnatiSCRP
  10511. on mouseUp
  10512.   cityButtonPush (the short name of me)
  10513. end mouseUp
  10514. -------------------------
  10515. on mouseDown
  10516.   cityButtonDown (the short name of me)
  10517. end mouseDown
  10518. -------------------------
  10519. on mouseLeave
  10520.   cityButtonLeave (the short name of me)
  10521. end mouseLeave
  10522. citycode
  10523. downcity
  10524. Button GoBack
  10525. leftcity
  10526. Indianapolis    rightcity
  10527. upcity    ClevelandTAIL
  10528. uetteSC+BUT
  10529. "INFO
  10530. IndianapolisSCRP
  10531. on mouseUp
  10532.   cityButtonPush (the short name of me)
  10533. end mouseUp
  10534. -------------------------
  10535. on mouseDown
  10536.   cityButtonDown (the short name of me)
  10537. end mouseDown
  10538. -------------------------
  10539. on mouseLeave
  10540.   cityButtonLeave (the short name of me)
  10541. end mouseLeave
  10542. citycode
  10543. downcity
  10544. Button NextDay
  10545. leftcity    DesMoines    rightcity
  10546. Cincinnati
  10547. upcity
  10548. ChicagoTAIL
  10549. DetroitSCRP+BUT
  10550. $INFO
  10551.     DesMoinesSCRP
  10552. on mouseUp
  10553.   cityButtonPush (the short name of me)
  10554. end mouseUp
  10555. -------------------------
  10556. on mouseDown
  10557.   cityButtonDown (the short name of me)
  10558. end mouseDown
  10559. -------------------------
  10560. on mouseLeave
  10561.   cityButtonLeave (the short name of me)
  10562. end mouseLeave
  10563. citycode
  10564. downcity
  10565. Button NextDay
  10566. leftcity
  10567.     rightcity
  10568. Indianapolis
  10569. upcity
  10570. LaCrosseTAIL
  10571. velandSC+BiO
  10572. DINFO
  10573. Help_Touchdata
  10574. RuA{    
  10575. D27Rc
  10576. RuAg^
  10577.  tgAV
  10578. Pq/=76
  10579. co0?S
  10580.     5677
  10581.     2577
  10582. 7(((    (((>
  10583. ((((((((
  10584. &(((>
  10585. 3(((3
  10586.     2557
  10587. {At,R
  10588. 6Ruto
  10589. =//=?
  10590. A21&c
  10591. t>k31
  10592. b21&o
  10593. co0?S
  10594. ]    &C9
  10595. {%9bB
  10596. ((((((((
  10597. 6666M
  10598. {{{t[wwK
  10599.         2567
  10600. 5??        
  10601. 66666
  10602. ((-J}}i
  10603. }}U<9(
  10604. ((<J}}
  10605. j}}l?((
  10606. J}}}6
  10607. 9(<[}}Q
  10608. }l?((
  10609. J}}}}|||6
  10610. ((>lUUUU}}k9
  10611. i}EUUUUD<((
  10612. P~K}-
  10613. ((<[}}i
  10614. k}}J>((
  10615. G9~(~9G
  10616. s\HK8!567
  10617. <=<=&
  10618. SSSSSS
  10619. 28-5E
  10620. OG2Kuy4
  10621. J!''!
  10622. 6K6c6
  10623. GFSSSSSSSSSSSSSS
  10624. 4"9>II}Y
  10625. }M{%Y.
  10626. _IIQ#4
  10627. ^``uuuuuuuuuuuuuu
  10628. 4)i>^>
  10629. rcYe    MP
  10630. SP(SSQc
  10631. 1'4p4
  10632. x(g7rg6w?8
  10633.         256
  10634. &q:(((:6,75*
  10635. 9&<5od
  10636. ?>?>>?>?>>?>?>?;
  10637. TfRNuuWrftJnsk|hh~srXu
  10638. Ri.i-
  10639. o(~XZ~XZ~XZ~XZ
  10640. $LN~ZX~ZX~ZX(~
  10641.         ?277
  10642. 9(<l}}Q9
  10643. 9(}cD
  10644. kE}J>((
  10645.         2267
  10646. CBCBCCC@@@@@@CCCC@@C@@@@@@@@@@C@C
  10647. ((>l}}
  10648. 8'(GiAy
  10649. 9j}}l?9(
  10650. vm~(&
  10651. ((>J}}
  10652. 8i}}U<9(
  10653. ((<}}}i
  10654. }l?((
  10655. ((.J}
  10656. }}J>((
  10657. ((>U}}k
  10658. mmmmmlmmlml2l5l2555
  10659. mmmmlmlml2l5l25555
  10660. mmmmmlmlml2l2l25555
  10661. mmmmmml|mlmlml2l2l#l555555555$55555$55$555555$5555555$5555
  10662. Y=?45
  10663. =445    
  10664. ^Y_YYY_Y
  10665. =?44    
  10666. =445    
  10667. XYXYY
  10668. YXYYYY
  10669. XYXYXYXXYXY
  10670. Y^^YXY^^
  10671. Y^^^^
  10672. ?5677
  10673. YXXXY
  10674. ?5567
  10675. HHIHH
  10676. SSSSSSSSSSSSSSSS
  10677. ^uuuuuuuuuuuuuuuu
  10678. eII---
  10679. edddde
  10680. ?=^^==d
  10681. =d=dd
  10682. =:^XY
  10683. >?>?>?>?>?>?>??
  10684. Y^YXX
  10685. 4RSRg
  10686. 6RSXe
  10687.         2577
  10688.         2577
  10689. _Y^^^
  10690. 6.m]X
  10691. XYXY_
  10692. _YXXY^^^^
  10693. 7662            
  10694. 7652    
  10695. 56666665
  10696. *+**?
  10697. }JUUUUUUUUUUUUUUUUUJUJJJJJJJJ
  10698. XXXXN
  10699. GGXNNQNXNXXXXX
  10700. XXXXX
  10701. X6XnXN
  10702. XXXXX
  10703. XXnXX
  10704. XXXnX
  10705. SSSSSSSSSSSSSSSS
  10706. Kuuuuuuuuuuuuuuuu
  10707. *+*+:(
  10708. UJUJU
  10709. QXQfx)(>(
  10710. >QQX\tky&33
  10711. >>346    >??>?>>
  10712. >?>?>?>?>>?>?>?;
  10713. GNQX-;:,
  10714.     ?257
  10715. GQGN-:,:
  10716.         2577
  10717. JJJGXNXQ
  10718. Gy6Ny
  10719. QXGQ)>,:B
  10720.         2577R'&x`'&x3
  10721. yu'7x3
  10722. F&&"u&&33
  10723. XNfnXXfN
  10724. XNNXn
  10725. XGGGG
  10726. XXXXXXX
  10727. XXXXXXXXXXXX
  10728. =<%jjt,t,t,t,vtvtvtvt,tt,t,t,t,t,t,v,t,,t,,v,.:;
  10729. >=)??<
  10730. )>mn+1lv
  10731. 77>(/
  10732. /(9>>(
  10733. (>>(9&?x.'
  10734. ??((?
  10735. ?((44((:%((:
  10736. 3(:/3)
  10737. >((7>
  10738. >&((/    ?x.'
  10739. 0??-(
  10740. >9:    .(
  10741. >(9>>((>
  10742. A7>((
  10743. 9(((((((
  10744. &&7&&7~
  10745. &&<=<&<=<&
  10746. <&<=<&
  10747. <&<=<&
  10748. &&97&&
  10749. Y7d^>v
  10750. ~~o~~~o
  10751. ~&~7~~
  10752. ~~o~X~X
  10753. 99999
  10754. 99&9&&
  10755. &X&~o
  10756. &BKg|>&
  10757. X&&&~X
  10758. ><=<7
  10759. }JlZ7Bh@|
  10760. ~&7~&
  10761. &X&&~~XZ
  10762. <=<7666
  10763. io&&&X
  10764. &999&&
  10765. 7dA$|
  10766. d9&XX
  10767. f7B7_
  10768. f,N&'
  10769. >3477
  10770. o&&7&
  10771. &=&<5
  10772. <=&<<
  10773. ~o~&p
  10774. SSSSSSSSWSSSSSSS
  10775. Wuuuuuuuu`uuuuuuu
  10776. ~o~&X
  10777. )o&&o~
  10778. `&&\7
  10779. Xg||$=
  10780.         2577
  10781. &9&9&&&~
  10782. >?>?>?>?>>?>?>?>k&O
  10783. >2<=<
  10784. &7&&&&
  10785. ~o|AZ
  10786. &=&&<=
  10787. R3<((
  10788. >%<((%
  10789. 3(((3((%<((%
  10790. (((3(
  10791. (((    (
  10792. (3(()
  10793. =((?>((>?((
  10794. (>?((
  10795. (((((
  10796. ((977(.
  10797. ~&&&X
  10798. 'o~~'
  10799. =<<44
  10800.         ?277
  10801. *+*+:(
  10802. }5}lKmHX
  10803. X7~Xo~X~
  10804. &=<&=<&<=
  10805. ?>>>3477
  10806.         2267
  10807. ((((((((
  10808. 7652        
  10809. 988^^
  10810. ^^9^x^
  10811. =>            
  10812. =''='=='==
  10813. dGY'=d]
  10814. `d='=
  10815. ~]d''=~
  10816. ]='='
  10817. ??<267
  10818. B==''
  10819. e0$>=
  10820. SSSSSSSSSSSSSSSS
  10821. vdY^'8
  10822. Wuuuuuuuuuuuuuuuu
  10823. `&&\7
  10824. ^^Yn0
  10825.     c:9^^Y    
  10826. ^$2~Y?
  10827. n34of`^|0Y^
  10828. "Z:n 
  10829. [8&_~0}^^'_|["9_
  10830. _9_9^[|_
  10831. fo`_^
  10832. >?>?>?>?>>?>?>?>k&O
  10833. 8_9X^'^g^^g
  10834. _9_'^8X^
  10835. ^8_&_
  10836. ^8_9_8^
  10837. _9_8_
  10838. 8_8^9
  10839. 8_9_8^~=
  10840. ^8_'^
  10841. `X`X`X~X `X]
  10842. `e` Y
  10843. ]X]X`:
  10844. Y`X]X`:
  10845. 7R&&&
  10846. [Za^S
  10847. kSRSkQkQkQkRRk
  10848.     2257
  10849. S7&x`'&x"
  10850. 7&33&&33
  10851. ce`;;#
  10852. &&((&&((
  10853. W&&>W&
  10854. u&&&S
  10855. &&((&&((
  10856. (&&((
  10857. >&&(7
  10858. &&((&`
  10859. {|kmFkp
  10860. &&(9&&((
  10861. (&&9(
  10862. (&7((
  10863. &&((&u
  10864. <9&&<(
  10865. {g(:Be
  10866. 15567
  10867. 9%$34477
  10868. *+**?
  10869. 12257
  10870. P9sE9
  10871.         2577
  10872. rj{,62
  10873. =<;78
  10874. N**;d
  10875.     5567
  10876. ^^g99999(wNM\5D
  10877. ^X***r
  10878. 9oNMM
  10879. {{OA++AP7
  10880. 9gg^|
  10881. &&33'Q
  10882. hD'&i3
  10883. BM{P+
  10884. B{RBBi
  10885. {ig7^^
  10886. W&&&q
  10887. SSSSSSSSSSSSSSSW
  10888. R''&&&&&u
  10889. &7&&&&
  10890. 7('&&79(3
  10891. *+*+:
  10892. 9$Q#M
  10893. DLQQ    
  10894. aja1^
  10895. {Bs^!D3
  10896. >?>?>?>?>>?>?>?;
  10897. 7S&&&
  10898. X3DDIw
  10899. 99P9ii
  10900. 7(((    (({
  10901. &(((>
  10902. k&&&M
  10903. B&&&u
  10904. >&&(&
  10905. >&&(7
  10906. 9>+,33#32
  10907. ivt!!.$<=3=
  10908. <393%3
  10909. &&((&&
  10910. &7((7&
  10911. (&&((
  10912. (&7{Y
  10913. 3<(>>((7>
  10914. >&((&        
  10915. :)3>>
  10916. 77>(>
  10917. >((>>(
  10918. (>>(9&?x.'
  10919. ((?3(
  10920. :(:    ?    4
  10921. )>>((>
  10922. ((77    
  10923.     ((:7
  10924. :(:    ?    4
  10925. <;;2<
  10926. )>>)%
  10927. >?9???(?
  10928. >(((    (((7
  10929. 3(((3
  10930. >(((7
  10931. 4>?>>>347
  10932. ;+*+:
  10933.         2267
  10934.         2577
  10935.     2257
  10936.     2257
  10937.     2567
  10938. *+*+:(
  10939. 77777
  10940. 67777
  10941. EINFO
  10942. Help_Remotedata
  10943. RuA{    
  10944. XzRuAg^    
  10945. RuAg^    
  10946. RuA{    
  10947. {uA9c
  10948.     5577
  10949. )(%B}
  10950.     2557
  10951.     2557
  10952. 3(((3
  10953. (>34477
  10954. RuAgbo
  10955.     5577
  10956. 8S3%8S34
  10957. 0"*813
  10958. cSbZi
  10959. <%X/1
  10960. =//=>
  10961. A21&c
  10962. )?(z*
  10963. 6666666666666
  10964. (((?((9>
  10965.         2567
  10966. 66666
  10967. (((((9((
  10968. (9(((((9
  10969. ((<J}}i
  10970. }}U<((
  10971. *+**?(
  10972. ((<J}}
  10973. j}}l.((
  10974. J}}}6
  10975. (9<J}}Q
  10976. }l?((
  10977. J}}}7
  10978. ((>l}}k9
  10979. i}}U-((
  10980. P~K}-
  10981. (9<J}}i
  10982. k}}J>(9
  10983. PJKK-766
  10984. ((<l}Ei
  10985. Q}EJ-((
  10986. G9~(~9G
  10987. s\HK8!567
  10988. <=<=&
  10989. SSSSSS
  10990. 28-5E
  10991. Ss?Q=
  10992. S==SS
  10993. es?S=
  10994. uBBH=    ?557
  10995. J!''!
  10996. 6K6c6
  10997. GFSSSSSSSSSSSSSS
  10998. 4"9>II}Y
  10999. }M{%Y.
  11000. _IIQ#4
  11001. ^``uuuuuuuuuuuuuu
  11002. 4)i>^>
  11003. rcYe    MP
  11004. SP(SSQc
  11005. 1'4p4
  11006. g7rg6w?8
  11007.         256
  11008. &q:(((:6,75*
  11009. 9&<5od
  11010. ?>?>>?>?>>?>?>?;
  11011. TfRNuuWrftJnsk|hh~srXu
  11012. Ri.i-
  11013. o(~XZ~XZ~XZ~XZ
  11014. $LN~ZX~ZX~ZX(~
  11015.         ?277
  11016. 9(<l}}Q9
  11017. 9(}cD
  11018. kE}J/((
  11019.         2267
  11020. 7523    
  11021. 9(<J}}i
  11022. !coQ9
  11023. }J/((
  11024. ((>l}}
  11025. 8'(GiAy
  11026. 9j}}l?((
  11027. vm~(&
  11028. (9<l}}i
  11029. }l?((
  11030. ((?J}
  11031. }}J/((
  11032. *+**?(
  11033. ((>UUUU
  11034. k}}UUUU
  11035. *+*++
  11036. Y:,55
  11037. ^^XY^
  11038. ^Y_YYY_Y
  11039. =?44    
  11040. =444    
  11041. =444    
  11042. =444    
  11043. =444    
  11044. Y^^^XXY^^^
  11045. ^^^^^YXY^^Y
  11046. XY_YXY^
  11047. Y^^^YXY_Y
  11048. XY^^^^^
  11049. YXY^^^^YX
  11050. ^^^Y_YX
  11051. Y^^^^
  11052. YYYXY
  11053. HHIHH
  11054. SSSSSSSSSSSSSSSS
  11055. ^uuuuuuuuuuuuuuuu
  11056. eII---
  11057. edddde
  11058. ?=^^==d
  11059. =d=dd
  11060. =:^XY
  11061. >?>?>?>?>?>?>??
  11062. 4    SRSZ
  11063. XXXYY
  11064. 5RSRg
  11065.     ?257
  11066.     ?257
  11067. 53(>(
  11068. (((43(((    
  11069. ((:&7:(9
  11070.     (9(3
  11071. ((    (((>
  11072. ((    (((/7:(9
  11073.     (((3
  11074. ((>?(9    (?
  11075. 4RSRg
  11076. 6RSXe
  11077.         2577
  11078.         2577
  11079. _Y^^^
  11080. 6.m]X
  11081. XYXY_
  11082. _YXXY^^^^
  11083. 7??_SR
  11084. RQRRQ
  11085. 66.[X
  11086. SRSRRRRRSRRSRRQRS
  11087. RRQRQ
  11088. 7652    
  11089. 56666665
  11090. }JUUUUUUUUUUUUUUUUUJUJJJJJJJJ
  11091. XXXXN
  11092. GGXNNQNXNXXXXX
  11093. XXXXX
  11094. X6XnXN
  11095. &&&>&&&>
  11096. >&7C>39
  11097. d&&ud&
  11098. u((&&((
  11099. &&&&&C
  11100. XXnXX
  11101. XXXnX
  11102. SSSSSSSSSSSSSSSS
  11103. nXXXX
  11104. QNGf2:&
  11105. R&&&u
  11106. (&&((
  11107. ::!=        2577
  11108. '&-/'
  11109. >?>?>?>?>>?>?>?;
  11110.         2477
  11111. ((:74<((
  11112.     /((7
  11113. >9((    
  11114. (    ((%
  11115. >(((    (
  11116. )((    9(
  11117. (((((9(
  11118. GNQX-;:,
  11119.     ?257
  11120. GQGN-:,:
  11121.         2577
  11122. JJJGXNXQ
  11123. Gy6Ny
  11124. QXGQ)>,:B
  11125.         2577R'&x`'&x3
  11126. yu'7x3
  11127. F&&"u&&33
  11128. GQQN$>;:
  11129.     ?257
  11130. 9&&((
  11131. XNNXn
  11132. XGGGG
  11133. XXXXXXX
  11134. XXXXXXXXXXXX
  11135. =<%jjt,t,t,t,vtvtvtvt,tt,t,t,t,t,t,v,t,,t,,v,.:;
  11136. >=)??<
  11137. )>mn+1lv
  11138. 77>(/
  11139. /(9>>(
  11140. (>>(9&?x.'
  11141. ??((?
  11142. ?((44((:%((:
  11143. 3(:/3)
  11144. >((7>
  11145. >&((/    ?x.'
  11146. 0??-(
  11147. >9:    .(
  11148. >(9>>((>
  11149. A7>((
  11150. 9(((((((
  11151. &&7&&7~
  11152. &&<=<&<=<&
  11153. <&<=<&
  11154. <&<=<&
  11155. &&97&&
  11156. Y7d^>v
  11157. ~~o~~~o
  11158. ~&~7~~
  11159. &X@gZ$
  11160. X~Xo&X
  11161. &9&7&&
  11162. &BKg|>&
  11163. X&&&~X
  11164. ><=<7
  11165. }JlZ7Bh@|
  11166. ~&7~&
  11167. &X&&~~XZ
  11168. <=<7666
  11169. io&&&X
  11170. &999&&
  11171. 7dA$|
  11172. d9&XX
  11173. >7BA5<
  11174. 9?=    2577
  11175. o&&7&
  11176. &=&<5
  11177. <=&<<
  11178. ~o~&p
  11179. SSSSSSSSWSSSSSSS
  11180. Wuuuuuuuu`uuuuuuu
  11181. ~o~&X
  11182. )o&&o~
  11183. lJk~g|
  11184.     ?25/
  11185. 7^M37^
  11186. S&&xl&&
  11187. &7((7&
  11188. 8X&u)
  11189. &&((&
  11190. 'V&u)
  11191. io~&X
  11192. ~&~X~&
  11193. &9&9&&&~
  11194. >?>?>?>?>>?>?>?>k&
  11195. >2<=<
  11196. &7&&&&
  11197. ~X~7~Bh$&=&&
  11198. X&&7&&
  11199. &&&X~$
  11200. ~&&&X
  11201. 'o~~'
  11202. =<<44
  11203.         ?277
  11204. X&~&7~9
  11205. &&9&G
  11206. X~o~o~X~m~BhgZgg|ZZK%v
  11207. $Z$?$
  11208.         2267
  11209. ((((((((
  11210. 7652        
  11211. ^^&Y^Y
  11212. =?            6
  11213. %        66
  11214. 88^'d
  11215. ]=='=
  11216. ]'='=d
  11217. &??5567
  11218. B=d'=
  11219. SSSSSSSSSSSSSSSS
  11220. Wuuuuuuuuuuuuuuuu
  11221. 63n:Y
  11222. B!>dB
  11223. `&&\7
  11224. Z*>5=
  11225. e&_^~    &_
  11226. =|^^O2
  11227. 88X n
  11228. o0f^^h0Y
  11229. Y[7X4|XZ0
  11230. _&_|0
  11231. '^[o6o]_&_
  11232. ^f|^io^9_
  11233. >?>?>?>?>>?>?>?>k&
  11234. ^Y^g^
  11235. _9_9_
  11236. 8_9:d
  11237. ^8^^9_
  11238. ^gYX9X9
  11239. XY`X]^`e
  11240. `XY`e`Y`eY
  11241. `X`e`:d
  11242. __98'_9_
  11243. Y'''Y
  11244. ''=d'=
  11245. 7R&&&
  11246. gnmbY^f\
  11247. kStS]
  11248. 7752        
  11249.     2257
  11250. S7&x`'&x"
  11251. 7&33&&33
  11252. B7&&d
  11253. W&&&q
  11254. O'7&i
  11255. [->=v
  11256. W&&>W&&>
  11257. u&&&S
  11258. &&((&&((
  11259. (&&((
  11260. >&&(7
  11261. &&((&`
  11262. {|kmFkp
  11263. &&(9&&((
  11264. (&&9(
  11265. (&7((
  11266. &&((&u
  11267. &&99'&n
  11268. <9&&<(
  11269. p988H
  11270. 15567
  11271. {$34477
  11272. 42567
  11273. "    2577
  11274. 12257
  11275. C^^g99
  11276. ^ACz$ZBmw:
  11277.         2577
  11278. N**;d
  11279.     5567
  11280. *+*+:(
  11281. 99gg^
  11282. NwttB
  11283. z4477
  11284. 9^X***r
  11285. 9oNMM
  11286. N89(v{$
  11287. {{OA++AP7
  11288. 9gg^|
  11289. &&33'Q
  11290. hD'&i3
  11291. {M{P+
  11292. B{RBBi
  11293. {ig7^^
  11294. W&&&q
  11295. SSSSSSSSSSSSSSSW
  11296. C^w7[#
  11297. S&&&u
  11298.     &&70
  11299. 6&&(&
  11300. DL7@    
  11301. >?>?>?>?>>?>?>?;
  11302. 77651"
  11303. 9xM~G
  11304. "(((3((%<((%
  11305. (((7(((3(
  11306. ((    (((>
  11307. (((33(((    
  11308. )((    (
  11309. ((3<((
  11310. 4(>3(((
  11311. 7S&&&
  11312. +.'^g
  11313. X3DDIw
  11314. 7(((    (({
  11315. &(((>
  11316. 9!N))
  11317. :"{99
  11318. >&&(&
  11319. >&&(7
  11320. 9>+,33#32
  11321. ivt!!.$<=3=
  11322. <393%3
  11323. &&((&&
  11324. &7((7&
  11325. (&&((
  11326. (&7{Y
  11327. >?9???(?
  11328. >(((    (((7
  11329. 3(((3
  11330. >(((7
  11331.     0257
  11332.         2577
  11333.     2257
  11334. IINFO
  11335. Help_BackToMap_hilitedata
  11336. >(()K
  11337. K=((>
  11338. :[[Fa
  11339. dYY==d
  11340. =='=d
  11341. u63Z=Y
  11342. 9/%Y4=%
  11343. 9~Y70
  11344. Y3?d^
  11345. ^x^^&2
  11346. -_    5%
  11347. 2|^^O 
  11348. oY^^i0
  11349. ^Y[n6[
  11350. YoZ^^
  11351. 0|_'^
  11352. Z4o0]
  11353. fo^9^Krd^[_
  11354. 8_8_9
  11355. ^9^^^`X
  11356. YOX`}X~XY`
  11357. Y`X]^
  11358. X `e`e`e
  11359. *TAIL
  11360. d+BUT
  11361. JINFO
  11362. Help_BackToMapSCRP
  11363. on mouseUp
  11364.   global gWChilitedBtn
  11365.   global gNAVcdev
  11366.   global gWCcd_or_bg
  11367.   --  global gNAVEpcotPath
  11368.   global gWCpath
  11369.   global gWCvoicePath
  11370.   global gWCmainMusic
  11371.   global gpathAudio
  11372.   clearIdleAlarm
  11373.   play stop
  11374.   send mouseLeave to cd btn (the short name of me)
  11375.   send mouseDown to cd btn (the short name of me)
  11376.   send mouseLeave to cd btn (the short name of me)
  11377.   send mouseDown to cd btn (the short name of me)
  11378.   send mouseLeave to cd btn (the short name of me)
  11379.   lock screen
  11380.   if gNAVcdev is "REMOTE" then
  11381.     hide cd bmp "Help_Remote"
  11382.   else
  11383.     hide cd bmp "Help_Touch"
  11384.   end if
  11385.   hide cd btn "Help_BackToMap"
  11386.   unlock screen
  11387.   enableNavBtn
  11388.   put "Help" into gWChilitedBtn
  11389.   if gNAVcdev is "REMOTE" then
  11390.     put "Background" into gWCcd_or_bg
  11391.     send mouseDown to bg btn "Help"
  11392.   end if
  11393.   start cd timer "alarmSelect" of cd "National" expire in 2100 ticks
  11394.   --play file (gNAVEpcotPath & gWCpath & gWCvoicePath & gWCmainMusic) nowait
  11395.   set the soundFile of bg snd "main" to 
  11396.      (gpathAudio & gWCmainMusic)
  11397.   set the bufferSize of bg snd "main" to 180
  11398.   set the playVolume of bg snd "main" to 100
  11399.   play bg snd "main"
  11400. end mouseUp
  11401. -------------------------
  11402. on dismissPopup
  11403.   global gWChilitedReg
  11404.   global gNAVcdev
  11405.   global gNAVEpcotPath
  11406.   global gWCpath
  11407.   global gWCvoicePath
  11408.   global gWCmainMusic
  11409.   send mouseLeave to cd btn (the short name of me)
  11410.   play stop
  11411.   lock screen
  11412.   if gNAVcdev is "REMOTE" then
  11413.     hide cd bmp "Help_Remote"
  11414.   else
  11415.     hide cd bmp "Help_Touch"
  11416.   end if
  11417.   hide cd btn "Help_BackToMap"
  11418.   unlock screen
  11419.   enableNavBtn
  11420.   put "Help" into gWChilitedReg
  11421.   if gNAVcdev is "REMOTE" then
  11422.     put "Background" into gWCcd_or_bg
  11423.     send mouseDown to bg btn "Help"
  11424.   end if
  11425.   start cd timer "alarmSelect" of cd "National" expire in 2100 ticks
  11426.   --play file (gNAVEpcotPath & gWCpath & gWCvoicePath & gWCmainMusic) nowait
  11427.   set the soundFile of bg snd "main" to 
  11428.      (gNAVEpcotPath & gWCpath & gWCvoicePath & gWCmainMusic)
  11429.   set the bufferSize of bg snd "main" to 180
  11430.   set the playVolume of bg snd "main" to 100
  11431.   play bg snd "main"
  11432. end dismissPopup
  11433. -------------------------
  11434. on mouseDown
  11435.   global gWCacceptMouseClicks
  11436.   clearIdleAlarm
  11437.   if gWCacceptMouseClicks is not "false" then
  11438.     do "show cd bmp" && quote & (the short name of me) & "_hilite" & quote
  11439.   end if
  11440. end mouseDown
  11441. -------------------------
  11442. on mouseLeave
  11443.   do "hide cd bmp" && quote & (the short name of me) & "_hilite" & quote
  11444. end mouseLeave
  11445. downcity
  11446. leftbutton
  11447. leftcity
  11448. rightbutton
  11449.     rightcity
  11450. upcity
  11451. KINFO
  11452. AGM:Desktop Folder:POMO folder:Audio:TchUSmsc.aif
  11453. mainTAIL
  11454. ~bkgd
  11455. Zdata
  11456. ~~~~~~~
  11457. v``Q!"
  11458. <****
  11459. v``Q!"
  11460. 1111177
  11461. v``Q'$
  11462. vvxxvvv
  11463. vv``''$"
  11464. 0-08<
  11465. 117177
  11466. vvv~xv
  11467. ~~~~~
  11468. ~vxvv
  11469. pvvvvv
  11470. xxvvv
  11471. x~xvv~v~
  11472. v~vxx
  11473. xvxvv
  11474. vxvvv
  11475. ~~~~~~
  11476. 1!171717
  11477. vv``''11
  11478. 7(777(7'
  11479. vvvvv
  11480. 7717""
  11481. v```'11$
  11482. vvvvvvvv
  11483. vpvvvu
  11484. vvvvvvsv
  11485. vv`fpvvf``fv
  11486. >71'!!1771
  11487. ~~~~~~~
  11488. ~~~~~
  11489. 7!W``vvvvvvvvs
  11490. v`WW4"
  11491. !WWWv
  11492. --2--
  11493. ""'!`
  11494. vfRW4
  11495. "7!W``v
  11496. ""'/``p
  11497. xxxxx~~
  11498. "$'/`fpx
  11499. ~~~~~~
  11500. pvvvpvv
  11501. :(???
  11502. eGFH)
  11503. ??=8=
  11504. ==:?:
  11505. ?::?=:
  11506. ==8:?=8
  11507. y~if"
  11508. ??DF}F
  11509. 88:8=888=:8=8?=88
  11510. 8:??=8==8:::?=?===:8
  11511. :?:?===
  11512. ?=8:?===
  11513. ?:==?
  11514. ==???
  11515. ??????
  11516.     ppv`
  11517. p~cf&(:
  11518. =DFFD
  11519. :8:=88
  11520. 8=88==8=?::
  11521. ?=8:?8====:?===
  11522. ?:=:8?=
  11523. ???==
  11524. ?;?????
  11525. =8:88=:=8:8
  11526. 8:=8:?
  11527. 8:==8=::?
  11528. ?:=?88:=8?==
  11529. ?=8==
  11530. ::=?=:===
  11531. ?8==:=88
  11532. 8===:?8888?==:
  11533. :?888:
  11534. ???8=?8=88::?
  11535. ?=::=?=
  11536. ?==??8
  11537. ;;;;;?
  11538. ??????
  11539. 8888:=8??=
  11540. ?=?======:?:
  11541. :?:::8??
  11542. ???:???=??
  11543. ?==??
  11544. ???==
  11545.     ;;;;
  11546. 888:=8:==88=8
  11547. =8:?=
  11548. ?==:=8
  11549. ?8=?=
  11550. ?:=??
  11551. ?==?=??
  11552. ???=??
  11553. ??=??==?
  11554. ??===??
  11555. :==88
  11556. =8:==8:=8
  11557. 88?==88:8:==?:8::
  11558. =8?===?=:?
  11559. ????=??=
  11560. ?::??
  11561. ?8==?
  11562. =?=??
  11563. ?????
  11564. ~~~~~
  11565. ==88:=8
  11566. 8=8==8?::==?
  11567. :::?=8
  11568. ===?8?8:?
  11569. :?:?8
  11570. ?????????
  11571. :8::=888
  11572. 888=8
  11573. 888=8?::====8
  11574. =88:===??8?8:
  11575. ===8?=
  11576. :88=8
  11577. :?=8:8=88
  11578. 88::::
  11579. 88===888==??===8
  11580. :??=:
  11581. ??????
  11582. yyBU;;
  11583. 888:8
  11584. :?=:?=8:
  11585. ====:?
  11586. :=?=?=
  11587. ????=?
  11588. ????=
  11589. ???;????
  11590.                         
  11591. :=?==:?:?===8?
  11592. :==8?8:
  11593. y}}}}}}
  11594. ???=?
  11595. 888==
  11596. :88:8888
  11597. :?8===
  11598. :==8?8?=
  11599. ?====
  11600. 8888=8
  11601. 8=?:===
  11602. 8:?8====:=======
  11603. ~~~~~
  11604. NWWNWNWNNNWNNN{g
  11605. 88=88N|K~C~C~L====?=
  11606. CCTZZ#''''''
  11607. ////11/11/
  11608. '11/1111///
  11609. yQCYZQCCK
  11610. ?????
  11611. 88:888
  11612. ::8=8
  11613. xlj~l~CC
  11614. 88=8=::88=88=8=8
  11615. ??????
  11616. ==sF3
  11617. 88=8=:88
  11618.     <lZ3
  11619. ==_y*
  11620. {~~~{~{
  11621. !Z'/0
  11622. III-III-I-F-I
  11623. ===1{*
  11624. 8888=
  11625. 888888
  11626. ddddddddddd
  11627. ~~{{~~
  11628. 88888
  11629. :888888
  11630. Ydd~Y
  11631. 8:888
  11632. ==d'Y~Y~d
  11633. ,,((,,
  11634. 88888
  11635. =5?>?
  11636. fZ|d|Z|||
  11637. ~~~~~~
  11638. 18..8.8
  11639. 88888
  11640. g4c-8
  11641. {~~~{~{~
  11642. |>99>:=
  11643. oGKzWw
  11644. 2mR]N
  11645. Rgqq5
  11646. nUBB;
  11647. 626226(RyqR
  11648. ;??-"
  11649. vvvvv
  11650. uxmuxmux
  11651. vvsvsvvv
  11652. 8    48:
  11653. vvvvxvv~v~~{{~
  11654. {W0000E~
  11655. uEW500Mu
  11656. 85005005
  11657. xEW00W,}
  11658. 0000000g
  11659. vFW000*sa
  11660. s]W00WTv
  11661. ./>8807'
  11662. 000W:
  11663. ===d=d=
  11664. *999:
  11665. =d=~Y'
  11666. vvxx~x~
  11667. =Yd=~YYi
  11668. ~~{~~~
  11669. vvxvvv
  11670. LZLZ(
  11671. +r`Pb
  11672. ;?;?;;
  11673. :Ly|q0
  11674. JJnq.
  11675. :8::L8
  11676. vvxxv
  11677. ;;?;??
  11678. <<<<<&
  11679. <<<#<#
  11680. <<<#<#
  11681. <###8#'
  11682. ##<#<?<
  11683. `%<+@D\??
  11684. !!2!!''''''d
  11685. 2!++88!
  11686. +727.>fgU{
  11687. mtttt~s
  11688. ,-,&?
  11689. ;?;?;
  11690. Q!Wr]
  11691. :2~SKN
  11692. 47`UG
  11693. zyrzr
  11694. ???;;
  11695. !cbc^+3
  11696. <vDb3O?qD@%
  11697. Q,tWN
  11698. "rxeF
  11699. yyyyyq
  11700. yyyyyyyy
  11701. yyyyy
  11702. 77777
  11703. 6~;;1
  11704. 8HFii
  11705. <~;;1
  11706. 3?r,O
  11707. ,?s,P
  11708. !JdsO$
  11709. !7LgR
  11710. -^,Maa
  11711. 2 rvN
  11712. |MLL(,
  11713. Loeo#
  11714. 3=M|\PYwom
  11715. <-_qR
  11716. 4JdwP$
  11717. IT45)
  11718. LL[Uss
  11719. -P(Mao
  11720. x8!?Ul
  11721. &[MU7%3
  11722. +3MeW
  11723. AaL_"
  11724. ZaM^(
  11725. e<<=Mvr\(
  11726. 77?[Tc
  11727. +2-fS]C"J}|{2 2)222=+
  11728. 2LMeN
  11729. e<<3avJV
  11730. Jeee+
  11731. AI]\    
  11732.     /(oT?:cX#
  11733. Fhs{F
  11734. ]Rs~W\C1
  11735. 0A\SsqV]
  11736. *88*4
  11737. "RWR~qSV\0
  11738. "C\W~s~WO
  11739. ]Ss~S]
  11740. >,-,,
  11741. (((,,
  11742. ((,,,
  11743. 1iiiii9?5
  11744. =T==5
  11745.         =/=
  11746. !?!?!!
  11747. }}}}y
  11748. =5555
  11749. {{{{`{`
  11750. ??5???
  11751. %%%'8'88
  11752. }}}y}
  11753. Y?.--
  11754. 88888=
  11755. =:(*(
  11756. :88::
  11757. (*8::8
  11758. wJ?~;-
  11759. #MM{XM*6MggM
  11760. $AZM~
  11761. p_?]X;X
  11762.                 M/Ko"
  11763. 2("o0*
  11764.     4MMF
  11765. gwwwgwvw
  11766. =4MFlr
  11767. wwvvv
  11768. wwwww
  11769.                     
  11770. ?4y4aj
  11771. wgwwvg
  11772.                     
  11773. 4D??y
  11774. wwwggwvggv
  11775. owwwwggwwgg
  11776. ldlowlow
  11777. wwwggwww
  11778. wdloo
  11779. wwggww
  11780. vvvvvvvv6
  11781.     M2M2
  11782. towdwww
  11783. wvvvvv
  11784. lowwww
  11785. vvvvvvvvv
  11786. '3333
  11787. CJJr    
  11788. ]</IQF_
  11789. F@Un...
  11790. ~...P
  11791. 7PPPg
  11792. gURgOvzD
  11793. \\\.<6
  11794. r<!QFFQ
  11795. VOU2xmm
  11796. ]<6A]<6
  11797. ./P7....
  11798. ..b`FJt
  11799. OWA(}mz
  11800. ~~uvs
  11801. /aDa]<6*>>C(}
  11802. VMO'nm}
  11803. 8<<<N
  11804. 666/CC0Zs}s}
  11805. P../~
  11806. FOU4}vm
  11807. ,/66.
  11808. k666]0C00ss
  11809. bGO@"
  11810. ..b`FJr
  11811. pUFOYvm}
  11812. _jj_gAHt
  11813. 0U')_
  11814. }}}vv
  11815.     NSZZZ
  11816. mpCTc    
  11817. 1_xE}Nc
  11818. w]]6]
  11819. mpF"6
  11820. k]]]]]A
  11821. 2+_Z@"6
  11822.                     
  11823. kkkka
  11824. ]NkqbN
  11825.                     
  11826. k/6<]
  11827.     ?]]]x
  11828. a}aNkNaN
  11829. /PP/#
  11830. k%<<]
  11831. EZZF8S\Zt
  11832. /..oF@U
  11833.     R]_T
  11834.                         
  11835. w666AA]
  11836. >FFNm
  11837. vLAF6
  11838. ./|tFOj
  11839.                     
  11840.                     
  11841.                     
  11842. u}uwu
  11843. akJ]r]r]r]r]r-
  11844. 455+g
  11845.                     
  11846. 103C1
  11847. aaNaNaNaNaN
  11848.                     
  11849. g}hq2
  11850. kJAAAA]]
  11851. k}w}}ak
  11852. ^)))^)mC
  11853. ))))^)#
  11854. kw6]A
  11855. 334P4p
  11856. ?0334P'-
  11857. 55555
  11858. $5$5$
  11859. J:<66
  11860. kw.6]A
  11861. &ejjmeM:x
  11862. 'P'!nj
  11863. !njsqj+}VM<
  11864. tyq4t:V#
  11865. P'(qaL(VyL
  11866. 7gFJO
  11867. Q^Oin
  11868. ]<66k
  11869. kw"6]A
  11870. ~./.rFJFb
  11871. tKBZ.
  11872. _qjh.
  11873. 5Pqj_!
  11874. +qqhjqa0}baA
  11875. ?qjqufyqJ
  11876. <HOFv
  11877. .Kq?L_jfZ
  11878. 0fL?Lgjh5
  11879. +fg?L_qU
  11880.     &dziiu
  11881. ::::00
  11882. 8:::0
  11883. 8::::
  11884. :::0:
  11885. ./.w@@@
  11886. mmmoP
  11887. b\J@r
  11888. 69&9.99
  11889. bfrO_,6
  11890. 80000
  11891. blr@",2
  11892. 2gjbd
  11893. blv@",2
  11894. ""T@zrCvollbbXbX
  11895. llolrEvCtF@Fm"_"""_m@@rEvLlL
  11896. blr@",1
  11897. -r]+a
  11898. %%+%%
  11899. "%"""__+,/,2
  11900. 66,6_""Ol
  11901. blr@",2
  11902. ::blr@",2
  11903. 55555555
  11904. uuuuu
  11905. -]]}a
  11906. CC}}C#g/7
  11907. 77.PPgP}{}}J}}t}C{}{PPP7
  11908. :blLG",2
  11909. 5555555555555?5
  11910. !3<<9997
  11911. mmSSm
  11912. .g}C{}C}C
  11913. RURSSSSlSmTST
  11914. ::::::
  11915. ::::::
  11916. :::XUuz",6
  11917. 555555
  11918. 5555555555
  11919. A]]<]'
  11920. ~SmUSlSm
  11921. <::::::
  11922. blHz"/
  11923. ]]+!<}aa
  11924. :::::
  11925. bVr@",2
  11926. 555555
  11927. i<66k
  11928. A]<<wk
  11929. w666A
  11930. PW66fa
  11931. U777b
  11932. ]<66k
  11933. k%66]
  11934. ././6Zz@L
  11935. ::lrzv
  11936. mXm,vZo,
  11937. $55555
  11938. h]66]A
  11939. :::::
  11940. 4::::
  11941. :%C,2
  11942. ::4::
  11943. !<]]]<
  11944. :::::::4
  11945. ::::::
  11946. :::::::::
  11947. uuuuu
  11948. }}p]A-
  11949. ::::::
  11950. 4::::4::::4:::
  11951. ::::::::
  11952. ::l,7
  11953. 7\:4::4
  11954. :::::
  11955. :4:4:
  11956. ::::4
  11957. :::<:::::4
  11958. :::::
  11959. uuuwu
  11960. w66w}66w
  11961. A]]J}kkk
  11962. Uy7yLy7y
  11963. R/./2zz@
  11964. y@wT~oZo
  11965. lmo noo
  11966. :::::
  11967. AIN]+wkkk
  11968. :::4:
  11969. ::4::4::
  11970. ::::::::::
  11971. :<:44
  11972. AIN]+wkDk
  11973. :::4:
  11974. :4::4:::
  11975. :::::
  11976. ::::::
  11977. :44:::
  11978. <]r]!
  11979. ANfIa
  11980. Hg?aZXsqs
  11981. *>Fhl
  11982. 4:0rHH>SC
  11983. ?55?55
  11984. <]r]!
  11985. k]]A-
  11986. 44:4:::
  11987. uuuuu
  11988. <]r]!
  11989. D<<666wkDk
  11990. kkkkkI
  11991. +SP742JS
  11992. 2x:4:<:
  11993. :4:4:
  11994. k+A:}<]]]]r9
  11995. ::4::<:
  11996. YY^Y^
  11997. 5$$$$
  11998. dduduzuukuk
  11999.  Y,#4
  12000. ::4::
  12001. ukukkkkki
  12002. :::<|`Eb4
  12003. EYEYY
  12004. uu~u~%
  12005. ddndndQ
  12006. aaNEA
  12007. kw<]A!
  12008. :4:4444
  12009. 4:::::::
  12010. *+:+++++
  12011. 5$7&&7&8
  12012. 4:2r2
  12013. 55577J5$5$7
  12014. ~uuu~uuuu
  12015. a^^^^^
  12016. ddddddddddd
  12017. $$5$$
  12018. k6]]]A
  12019. dddduzddddd
  12020. kkk}.]A
  12021. :<4::
  12022. :4::::4
  12023. 555$5$?5
  12024. 577755755777
  12025. ::4::
  12026. 2S}{f-
  12027. 666k<66ka666]
  12028. '!A]66wk
  12029. R!./"tF2_CF
  12030. Rttz(
  12031. 4Fttw1
  12032. 71olo]
  12033.                             
  12034. .[Bw@
  12035. ,/646
  12036. 4VX[LwLtzGTy
  12037. +XUXX"7
  12038.  |<6"k
  12039. kw<6]`]66
  12040. kf"6]P
  12041. A666w
  12042. k666J!
  12043. ooo{!oooN
  12044. ^ ff8F
  12045. 888882EF
  12046. V,27.-
  12047. ^)))^)m-?
  12048. ^)))^)mC
  12049. 0\FRCtCpFBB/74
  12050. }434P4c
  12051. 334P4p
  12052. 26644
  12053. RBCh6
  12054. qy7yqU
  12055. .XF"647
  12056. .O}xJ}OPbS!44
  12057. R\TRRR
  12058. 0+FF_604
  12059. 22"J#RT
  12060. 744/{b
  12061. B|h>Hh
  12062.  qH[>XfpX
  12063. 2C|>>Hh
  12064. \J 27
  12065.                         
  12066.                     
  12067. 47}{.4747
  12068.                     
  12069. /<66k
  12070. y77.N
  12071. w666A
  12072. ]66!]666
  12073. ++v<66k
  12074. )ttF.
  12075. +pBl_.O.!
  12076. LXoo 72twtF
  12077. 17!~R
  12078.                     
  12079. 2744\B 
  12080. D$wkD
  12081. }I!]!k
  12082. =1&        
  12083. 446T+
  12084. BtBtB+
  12085. B6771cR
  12086. =,=..
  12087. 5555$5
  12088.                     
  12089. L6772O~
  12090. b}J-7
  12091. 55$5$
  12092.                         
  12093. ]]r]-
  12094. S227447-
  12095.                         
  12096. Rq@J-274
  12097. x4714
  12098. =====
  12099.  ZD17
  12100. bx217
  12101.             > 
  12102.                     
  12103.                     
  12104.                     
  12105. 7\+G$B
  12106. 555?5$
  12107.                         
  12108.                                         
  12109.                                 
  12110.                         
  12111. b}21-
  12112. {xJ/2214S
  12113. C~.44
  12114.                     
  12115. \621!
  12116. F<66D
  12117. k%<<]
  12118. N777y
  12119. k66<D
  12120. ..2|<66k
  12121. kw.<]l.66
  12122. k666J.+.
  12123. 5051CA}L.2
  12124. =ZR{]
  12125. k}$]]
  12126. VDBW7214
  12127. !G]WoMWh,
  12128. 444_G
  12129. 44471244
  12130. 21448
  12131. 47/c144A4
  12132. 4444-b~J~}
  12133. 555555
  12134. ui<66k
  12135. .22|<66k
  12136. k%66K
  12137. *0%)i
  12138. f.>>4
  12139. 4kBh_!b~}\-\\\R
  12140. M~Pt/
  12141. ]_214!qq\\\\
  12142. RO.22
  12143. Auuui<66k
  12144. D666D666
  12145. w666U
  12146. 9222J<66k
  12147. k66/K.)3%mji{
  12148. wqwQ U
  12149. /H644
  12150. uuui<66k
  12151. D"66N"66
  12152. k666J
  12153. %223J<66k
  12154. k666D**3)ii{x
  12155. ?YhBT
  12156. t~QQ'
  12157. vzvwv
  12158. advM=I
  12159. kkkkkkkkDkDkDkDkf]
  12160. /W211.OR
  12161. ;`uHXZ6`wZHfyk
  12162. Auuui<66k
  12163. ]<66k
  12164. %333J666k
  12165. k666F*2*+iqix
  12166. /]\hs5
  12167. 56PO-!q\
  12168. 55555
  12169. qQW- 
  12170. A4uu43<6]/ak
  12171. r<66D
  12172. 2=2`<66w
  12173. k666F.
  12174. ,[GhE
  12175. 55555
  12176. 55555
  12177. 0&Tlrv
  12178. aa__27
  12179. Ruuu'
  12180. AY$66.
  12181. '2=&(66"
  12182. 6664***(
  12183. &(&Zrrv
  12184.     {tnZ(-
  12185. k%<6p/66
  12186. w66<X
  12187. ?2=S<66D
  12188. 666-.
  12189. .kvFy
  12190. 22"J}O\
  12191. -,SO-p
  12192.     |fYZ(2
  12193. AAAAAAAP]r]r]r]]]]]]]]]<666666}}}}}}}laNaNaNaaaaaaaaa
  12194. \\\\\qp
  12195. \O141
  12196. uuJr]r]
  12197. k%66]N<66k
  12198. k666J
  12199. ==2|<66k
  12200. vaf`(6
  12201. k666J
  12202. (???V666w
  12203. `lh{    
  12204. yr_W,%
  12205. /hADl
  12206. TTT^*
  12207. uuss`
  12208. \S-441
  12209. ~1114
  12210. ~EEEY
  12211. ^lTT9
  12212. \S-441O
  12213. 44,hAf]
  12214. 58882
  12215. 28228
  12216. mEEEE
  12217. T^l^?*
  12218. O41444
  12219. 1,mAB
  12220. ~E~EX:828
  12221. 82288
  12222. 8282aFE~E
  12223. l^w^?*
  12224. 4iTlT
  12225. Et}~-
  12226. 82822
  12227. 22822222aFE~E
  12228. ^^w^Z**
  12229. -4111,v411
  12230. J414114
  12231. -AOElO
  12232. F~EEa28
  12233. 228822
  12234. 22822222222
  12235.  1441\@
  12236. 41112
  12237. 41111,hAD
  12238. $YlOl
  12239. }tFtU228222
  12240. 08028
  12241. 211/mAA
  12242. **-9lElE
  12243. OFQ228
  12244. 2521E
  12245. -$t8:
  12246. Uy7yUz
  12247. 8:2222wJ
  12248. 91111
  12249. 82222&
  12250. kkkkkDk
  12251. g82220}
  12252. kkkkDkDkww
  12253. 666]]IIIf]
  12254. AIv}vx}{
  12255. 1luTt
  12256. 08220
  12257. nn+666
  12258. <]r--<66
  12259. kkkk/
  12260. 3EPAA
  12261. m~~P8..
  12262. ddd%666w
  12263. +JJi<66k
  12264. k<<6]AAA-AAA-
  12265. jm~~%8..
  12266. Eddd|666k
  12267. /c6w/c6WqqqG
  12268. fgWW7
  12269. -AAAr]r]]]]]<6-
  12270. ++++]666k
  12271. k.6<]
  12272. edds+66!
  12273. k666]
  12274. U666QqjjX
  12275. 7/]]`E
  12276. 4+++r<66D
  12277. k%6<]
  12278. P]r]"
  12279.     w666V!!!6
  12280. ..~Jddq<66f
  12281. w666V
  12282. c66.U
  12283. "66-sgg|
  12284. NaNaaa
  12285. EuLd+A666w
  12286. D66<rr<66D
  12287. 6666!!'6
  12288. w666V
  12289. b}2}GXby!!U
  12290. kkkDkw6]
  12291. 8:000
  12292. kkDkD
  12293. kkkDkw.6]]Ir]A
  12294. -]bv[M[d]
  12295. (WvHvo(\wvn
  12296. Hf`?yyyg
  12297. ?unuJ
  12298. ]<66k
  12299. 6<]!]<66k
  12300. U777b
  12301. ~~VJJJJ<66k
  12302. "66*+??)
  12303. kkkDkw.6]]If]A
  12304. kkkDkf
  12305. 6]]If]A
  12306. /'c/c"".
  12307. 2<79!
  12308. p<]]If]P-
  12309. -AP]r]
  12310. -c/cw"!
  12311. /"""(tQ
  12312. AA]r]]<
  12313. unu_]66
  12314. f777Q
  12315. c66!U
  12316. "66/U44S
  12317. +$==&0''    
  12318. AA]r]]<6}}aNaa
  12319. nu4d<666
  12320. r]<6Na
  12321. .%66944Akm~
  12322. .%    ,,
  12323. -]]<!k
  12324. B  |Q
  12325. 555,=
  12326. 55555
  12327. fkw.r
  12328. GyypplB
  12329. ,,=,,
  12330. -+}laNa
  12331. ^)))^)m41
  12332. f"66DI<6"k
  12333. 666k<66k
  12334. 666U666U
  12335. ~.888
  12336. }}Z;$
  12337. iqcZe
  12338. w}Z;1
  12339. ;.O}}
  12340. ;.O}}
  12341.                             
  12342. +js%))
  12343. ;$O}}
  12344. .OEY^
  12345. XkSkk
  12346. kkkkkkkkkwkwkwkwk
  12347. 6666666<]]Ea
  12348. Vkkkkkkkkkfkwkwkww
  12349. 6666666]]]]]]]]]A]A]A]A]--------
  12350. ]]]]]]]]]P]A]A]UA-------!
  12351. S}Sa.
  12352. !!!!!!!!'
  12353. f>V-#
  12354. 1v>]h
  12355. A?nu4J
  12356. f"66f"66
  12357. k66<>666U
  12358. U666c
  12359. '-+>f
  12360. ~F..8
  12361. +++!!JJJA4A!!!!!!!!0V:0:0:0
  12362. 80>0>:
  12363. u~uuu~
  12364. u~u~u~~~
  12365. <001=
  12366. }}}}V.;;.;$;.;.
  12367. ~u~~~~~~
  12368. 8F}F~
  12369. w66w}66w
  12370. ~~8.$8
  12371. 1"*1""
  12372. 8t}tFtDt
  12373. ....8.....
  12374.                         
  12375. }FQFFFSDFSF
  12376. 202220000802000
  12377. ..8..
  12378. =,.=.,.,
  12379. /<66k
  12380. k%6<k%66
  12381. f"6"f"6"
  12382. m~~~.8.$
  12383. 57575$7$55575&
  12384. &555&5
  12385.                     
  12386.                     
  12387. 6334664
  12388. 36366
  12389. 6433>4443643
  12390. 63131613
  12391. $$.5$
  12392. 5555555
  12393. 6;3363
  12394. ;6'3;
  12395. ;8;83;
  12396. 4363>6
  12397. p333;
  12398. 113336
  12399. 33383;
  12400. ?5555
  12401. 555?5
  12402. ?5555?55
  12403. 5$555
  12404. 20X O
  12405. 555$$nY
  12406. 1?3313
  12407. 1uu11uu1
  12408. *C.d_-J]666k
  12409. 5"";N
  12410. c66"U
  12411. -.U/c-c!
  12412. 5336h
  12413. 5?55$
  12414. kwkkw]!
  12415. 03;86
  12416. w]A]]A
  12417.                     
  12418.                                         
  12419. ;'8FaOF
  12420. EO_d+
  12421. w666A
  12422. 46641
  12423. ]A]wk
  12424. uuu~uu
  12425. ICd-#k
  12426. ~~~~u
  12427.                     
  12428. ;;.;..8.
  12429. *t202O
  12430. u'fxCOF
  12431. qnAd]666k
  12432. k666]!!+!
  12433. s...(
  12434. OstDt
  12435.                     
  12436. cccmcK
  12437. {JP<66f
  12438. 66]:<66!
  12439. k%66p/66p<66D
  12440. xx``.
  12441. RDRRR
  12442. 55555
  12443. <111?
  12444. >!!!!!!!>
  12445. %                        
  12446. tggUU^1o^o^o^oggVgV
  12447. }wkw]]!
  12448.                     
  12449.                     
  12450. n5555
  12451. AAA]A
  12452. 888888
  12453. #rJZ$
  12454. Y00?Ai
  12455. iiA?)#J
  12456.     >>-%
  12457. $.."xk_L'4]666k
  12458. k666]!+!+
  12459. ~u~uu
  12460. ..1"~H_L
  12461. ..1$___J]666k
  12462. 666:!!
  12463. 8811        
  12464. 8881        
  12465. (!N]fo
  12466. ^^^^>M@Sm+'SSf9^g
  12467. ;nngJ]<66k
  12468. k66<D-++>
  12469. 9^^9mFF's#HNNk
  12470. 18M@bS*@S59^^9
  12471. qnns]66!
  12472. N66z8!+
  12473. 9999^^
  12474. `8M|~
  12475. @q_F@
  12476. 9^g 99
  12477. {qq966<
  12478. A]|!+'
  12479. *:_<)
  12480. 0IbIU
  12481. &:<:%
  12482. y8@/)6i
  12483. {{4<P
  12484. &%::%
  12485. R8j8jq
  12486. @i8uR
  12487. !!06!!'
  12488. &::%:
  12489. ^sss3###=
  12490. iP^77g
  12491. kl42!-
  12492. 5%\%*
  12493. :::5<
  12494. `syf9
  12495. 5%%%*
  12496. &%_'&%_8
  12497. gKJsg
  12498. ~sy@(
  12499. `"1.$
  12500. \_\%yd
  12501. :%%\%
  12502. Z9V|KJV
  12503. #k!!6
  12504. )g||E
  12505. 1rJ@V
  12506. :5:::
  12507. ?||r?
  12508. 2",gE|r
  12509. ''yjP
  12510. C%C&y:
  12511. y%\%_
  12512. "2,9||
  12513. ;t"rJJ
  12514. ZEu8a
  12515. xX&Xm822
  12516. s^1"'s
  12517. 4)!AQ
  12518. "7<UUU^g
  12519. 2-882Zww
  12520. dy%\\_
  12521. 11O^^
  12522. 888-888Z~hb
  12523.     4TooQ
  12524. 70Zt~
  12525. 8'>O^
  12526. 4)Ap[L
  12527. =/kggj    y''1^^^
  12528. %xllC
  12529. XAAA$
  12530. A$2==
  12531. 4*ApDE$
  12532. y''>^
  12533. 9{~b(
  12534. %|ssI
  12535. XAA|$==
  12536. A$$2=
  12537. *Ay{E$
  12538. vvwvv
  12539. ^EWZ-/
  12540. ;~jV?
  12541. b___U
  12542. 22287+
  12543. 8\%%%\\&#
  12544. 87*y11^
  12545. ^1"-7<
  12546. Y^^Y^
  12547. 8:%:\*:*:
  12548. DUUQ2
  12549. 2*&`1^
  12550. ^1|$78
  12551. ^^^^^^
  12552. *5555
  12553. tWS&SXV/
  12554. YX^Y_
  12555. n`1^^(78
  12556. XXYXXY
  12557. ;8*MX
  12558. GG<<<G
  12559. $y1~8
  12560. 8:#%#%\%\\%#
  12561. XXYX^
  12562. XXXXX
  12563. SSSSSSSSS
  12564. SSSSSSSSS
  12565. YXYXYXYX=
  12566. YXYXYXYY
  12567. YYYYYYYYY
  12568. {S*SS>$
  12569. dddQy
  12570. {dSdQc
  12571. XXXXX
  12572. ^^^^^
  12573. IHIHIHIH
  12574. IHIHIHII
  12575. IIIIIIIIIY
  12576. yErE(9N
  12577. XXXXX
  12578. ;8;;*XX
  12579. XXXXX
  12580. (c>c>
  12581. s(c>c>
  12582. ;111>4
  12583. ImII-==
  12584. -IFdY
  12585. ;;;;*XX
  12586. XXXXX
  12587. )""-.
  12588. 8;;;'XXXX
  12589. (+111
  12590. dd=d===
  12591. 88;;'XXX
  12592. {A99=
  12593. ;*XXX
  12594. *XXXX
  12595. s(c>c>c
  12596. $=/ktqM
  12597. `gtk/=
  12598. Id@YY==
  12599. S<0:)kgU
  12600. A||$=
  12601. SAf!%
  12602. E'!!N
  12603. *dd!*d{{{{(G
  12604. {S}Z<
  12605. {d{E!{{ZZ{{
  12606. {d{!!*{Z
  12607. {{!!d{!!
  12608. ??<-k~EO
  12609. -=>=0=>0
  12610. 8888888888
  12611. F8;;88;;
  12612. {{{{oX
  12613. dd=dd==
  12614. ddS#2
  12615. X*Sd{
  12616. #9|A|#
  12617. NNQ#9
  12618. (XZ'yE
  12619. P(SSS
  12620. 88888
  12621. 4'fTmfh
  12622. $$s$bKl
  12623. sxxpg
  12624. ##9#99
  12625. '9##927X
  12626. de@d~
  12627. YY==dY===
  12628. A$||=
  12629. XA||$=
  12630. ?8<-kEE
  12631. 88888888
  12632. ;8888
  12633. 88888
  12634. =YX@d
  12635. YYd@d
  12636. XoXXX
  12637. =YeYX
  12638. XXA||$=
  12639. XA||$=
  12640. 00kkCR
  12641.     ''88
  12642. 88888
  12643. ^^^Y^X
  12644.                         
  12645. 888888
  12646. 88888888
  12647. 888;888
  12648.                             =
  12649. 88888888888888888
  12650. 8888888
  12651. YXXYXXYX
  12652. lgOk/7
  12653. 88888888
  12654. 6:VSE_
  12655. Puuu)
  12656. 5$5$    
  12657. 88888888
  12658. <480`qS
  12659. pVUNX
  12660. V#]}3
  12661. PMuu%2
  12662. 2`k~E/
  12663. PuMu%
  12664. /3333
  12665. gjjj1
  12666. 82-kEEZ
  12667. 6604`
  12668. #C|NX
  12669. PPuu%%
  12670. 88888
  12671. R^kX>26
  12672. peJR4
  12673. 888888
  12674. jggZ:
  12675. ddludQdd5[
  12676. 4-kmrZ
  12677. 6680`
  12678. ?/Pamf
  12679. jkkZ0
  12680. 66::                
  12681. 888888
  12682. 88888888888
  12683. 88888888888888888
  12684. 66666666666666
  12685. 604GkSS
  12686. dukkn
  12687. ~~8OT
  12688. m~~uj
  12689. m~uuu~
  12690. 5=5$5=$$-
  12691. <-`mtZ:
  12692. 6>808>6>>X0X
  12693. ?$.P~~m---
  12694. ff>2X0
  12695. a~~P$
  12696. sxV@38
  12697. 8.8[3u
  12698. u~x~~
  12699. ssX$&
  12700. $'!-!
  12701. uudQ$
  12702. uwuwjfj
  12703. >--um~~38
  12704. 33&-ss
  12705. :63>    :    
  12706. un$d$5
  12707. *$.;FSS
  12708. aT-\.
  12709. 5KTRz
  12710. nT&*:
  12711. 6>44    >
  12712. nQ$Q5
  12713. Imkm.
  12714. $EEP.E~~
  12715. O}SEES~k1.
  12716. .;.;.
  12717. jgja&
  12718. _5<^_''8
  12719. )4XXuh
  12720. rg&&&?
  12721. 8888888888888888
  12722. fuwuuuu4
  12723. ....8?8
  12724. 88888
  12725. 8.8.8888.
  12726. 8-$;8-8-8
  12727. Z$;.-
  12728. $-$1$;.;$;$;.;.$;.;$
  12729.     v55%_
  12730. )dg}_)285D_\
  12731. 333Fuuu
  12732. -s84`
  12733. !rxxu
  12734. ==5=5
  12735. +!+.5?$'
  12736. hlxquz
  12737. $4?:63?+
  12738. guu{{
  12739. u{{{u
  12740. 55555
  12741. b"8%4
  12742. +'3<:?+"
  12743. kkrC?
  12744. 55555
  12745. 22ZS}}
  12746. qhhZ,66
  12747. 866:<
  12748. 8888888
  12749. 88888888
  12750. duwuu
  12751. 55$5$55
  12752. =55=55
  12753. 555555
  12754. 88888
  12755.                     =
  12756. #m~l`h
  12757. 6XX66
  12758. 86688    
  12759. $5$$    
  12760. 64#kkIZ8
  12761. >U]jn
  12762. pFvbn(
  12763. p{hh|
  12764. #SZhw
  12765. 266666(866(626
  12766.                         
  12767. =====5
  12768.                         
  12769. ((XZ#(!
  12770. $$55$5$55
  12771. i~usJ
  12772. }tr(Z(
  12773. WT-Z&(
  12774.                         8
  12775. 55555
  12776. hhlhr
  12777. <6242
  12778. rll((
  12779. h(6#v"
  12780. @$555
  12781. uuuuu
  12782. 55=58
  12783. (n(22
  12784. 22666222
  12785. uuuua
  12786. ukuuuu
  12787. d133~z
  12788.     55$5
  12789. 555555
  12790. 555555
  12791. 555555
  12792. 555=55
  12793. 55=5===5
  12794.                         
  12795. uuuuuu
  12796. u5iuj
  12797. uuuuu
  12798. 555555
  12799. 55555
  12800. 555555=5=5==
  12801. =55====55
  12802.                         
  12803. 66lvt
  12804.      $~uflud
  12805. uuudu
  12806. ====5
  12807. ===5=
  12808. 266666
  12809.                     
  12810. 55===
  12811.                     
  12812.                     
  12813. 6222(72
  12814. 22((r
  12815. lnrlllv
  12816. $@5ddn.
  12817. {uuuu
  12818. $5555}
  12819. 55555
  12820. =55555
  12821.                                 
  12822. 8(8668(
  12823. 6ZdZ6,6(PPXZ
  12824. 6(llnrlr
  12825. z~u~z
  12826.                 7
  12827. ,888dXb0
  12828. =5===
  12829. 55Q@z
  12830. nn$5JJ
  12831. ==5=5
  12832. vvhhr
  12833. rrrrrrrr
  12834. vg^Z6
  12835. }rvl#((2
  12836. =====
  12837.                             
  12838. 666226
  12839. tvrh6(22
  12840. uQ_5$
  12841. ~vbZ6(62
  12842. 6ZO@v
  12843. fhrh22
  12844. 55nn$$
  12845. $5555555
  12846.                     
  12847. 22222
  12848. rl626
  12849. 55555
  12850. (hflrr
  12851. lZZZ6:6ZWry
  12852. 777775    
  12853. 55555555
  12854.                         
  12855. 22266
  12856. rrprh
  12857. lflllbrl
  12858. rrlrr
  12859. rrrh-
  12860. lrrrl
  12861.                     
  12862.                             
  12863. 55555
  12864. rrrrlr
  12865.                         
  12866.                                 
  12867. =5==5[k
  12868. 8data
  12869. 5TAIL
  12870. )data
  12871. ggxgggxg
  12872. /P~~u~
  12873. ~xkkk
  12874. ZuE+a$a
  12875. xX&Xm822
  12876. dy%\;
  12877. ;%%\\\
  12878. ^XXYXYXYXY
  12879. %\\&#
  12880. PBsl6
  12881. Y^^^^^^
  12882. XY_Y_
  12883. I-d===
  12884. =<0)jS
  12885. <:)QS
  12886. g__FTl
  12887. <<<]qkS
  12888. =668`qm_
  12889. ^^YXXY^
  12890. uuu~u
  12891. F933u
  12892. 6680`
  12893. 3w}wf
  12894. 660XqSU
  12895. '''-'!(!
  12896. 3U}wwff
  12897. >:>:>:0:
  12898. 668666
  12899. 66>6>
  12900. XX#Im3U
  12901. uwuwjfj
  12902. Imkm.
  12903. m3OIC
  12904. guu{{
  12905. u{{{u
  12906. 55555
  12907. !!(!    
  12908. 1TAIL
  12909. +data
  12910. xgggxggg
  12911. /P~~u~
  12912. ~xkkk
  12913. ZuE+a$a
  12914. xX&Xm822
  12915. dy%\;
  12916. ;%%\\\
  12917. XY_YXY^
  12918. XYXXY_YX^
  12919. %lslC
  12920. %%%\\&#
  12921. %QBsI7
  12922. "QBsN
  12923. XY_Y_
  12924. %\\%#
  12925. =<:)p
  12926. gg_g8
  12927. ^^^YXXYX
  12928. 888888
  12929. 888888/-
  12930. Y^Y^^^^^
  12931. <<<4`qkS
  12932. uuu~u
  12933. FFF9uuu
  12934. 3wgff
  12935. 660XkSU
  12936. 6>808>6>>X0>f
  12937. uwuwjfj
  12938. Imkm.
  12939. m3OIC
  12940. guu{{
  12941. u{{{u
  12942. 55555
  12943. 4TAIL
  12944. -data
  12945. xgggxggg
  12946. /P~~u~
  12947. ~xkkk
  12948. ZuE+a$a
  12949. xX&Xm822
  12950. dy%\;
  12951. XY_YXY^
  12952. gggggggx
  12953. YYYY^
  12954. =lsl[
  12955. %%%\\&#
  12956. Y^^^^^Y_Y^^
  12957. ^QBs2
  12958. XY_Y_
  12959. %\\%#
  12960. -d=dX
  12961. gg_g8
  12962. <0)_S
  12963. ^Y^^^XY_
  12964. 88888
  12965. 888888
  12966. 888888/-
  12967. 86604`
  12968. uuu~u
  12969. FFF9uuu
  12970. 6680`
  12971. 3wwwl
  12972. 660XqSU
  12973. 6>808>6>>X0>f
  12974. `#868
  12975. uwuwjfj
  12976. Imkm.
  12977. aUOOO
  12978. guu{{
  12979. u{{{u
  12980. 55555
  12981. 0TAIL
  12982. /data
  12983. C%C&y:
  12984. ZEu8a
  12985. xX&Xm822
  12986. dy%\\
  12987. ;%%\\\
  12988. XY_YXY^
  12989. gggggggx
  12990. YYYY^
  12991. %%%\\&#
  12992. QBsl7
  12993. %QBsI
  12994. XY_Y_
  12995. %\\%#
  12996. =YXYX=
  12997. gg_g8
  12998. YYXYYYXY
  12999. ?<0)hS
  13000. 88888
  13001. 888888
  13002. 888888/-
  13003. Y^^^Y_
  13004. 6604`
  13005. uuu~u
  13006. FFF9uuu
  13007. 66>VkSU
  13008. 6>808>6>>X0X
  13009. uwuwjfj
  13010. >--um~~38
  13011. Imkm.
  13012. m3OIC
  13013. guu{{
  13014. u{{{u
  13015. 55555
  13016. 4TAIL
  13017. 1data
  13018. xgggxggg
  13019. /P~~u~
  13020. ~xkkk
  13021. ZuE+a$a
  13022. xX&Xm822
  13023. dy%\\
  13024. XY_YXY^
  13025. gggggggx
  13026. YYYY^
  13027. %%%\\&#
  13028. QBsl7
  13029. %QBsI
  13030. XY_Y_
  13031. %\\%#
  13032. XeeeY
  13033. gg_g8
  13034. YXYXY
  13035. ?<0)hS
  13036. Y^^^^^YXYX
  13037. <:a-kU
  13038. 888888
  13039. Y^^^Y_
  13040. 888888/-
  13041. uuu~u
  13042. FFF9uuu
  13043. 3wgff
  13044. 660XkSU
  13045. 6>808>6>>X0>f
  13046. uwuwjfj
  13047. Imkm.
  13048. m3OIC
  13049. guu{{
  13050. u{{{u
  13051. 55555
  13052. 2TAIL
  13053. g+BiO
  13054. 3data
  13055. C%C&y:
  13056. dy%\\_gggd
  13057. ;%%\\\
  13058. XY_YXY^
  13059. YXXY_YX^
  13060. %\\&#
  13061. Y^^^^^Y_Y^^
  13062. Y^^^^^^
  13063. XY_Y_
  13064. YYYYYYY
  13065. YYYYYYYY
  13066. YYXYXY
  13067. YIIIIIII
  13068. IIIIIIII
  13069. IHIHIHI
  13070. IIII-==
  13071. d====
  13072. =d=d====
  13073. IIIdddI--dIII
  13074. ddYY==
  13075. <0)Wk_
  13076. d=d==
  13077. tI-IIY
  13078. YIIIIII-I==IIIIII-Id==
  13079. YYdddd
  13080. YYYddd
  13081. YX^Xd
  13082. =======
  13083. ========
  13084. ^===Y
  13085. XY==d
  13086. <0)SS
  13087. TF3''
  13088. Y^^^^XYXXY
  13089. Y^^^X
  13090. XY^^Y_
  13091. g__FTl
  13092. <<<XqkS
  13093. ___3rxl
  13094. uuu~u
  13095. F933u
  13096. 6680`
  13097. dsF33
  13098. 66666666666666
  13099. 66>VqSS
  13100. 6666666
  13101. 0V0>``
  13102. `#868
  13103. uwuwjfj
  13104. 6864X`XkkkqqqSqqqqg
  13105. mju{~888~m
  13106. Imkm.
  13107. ....8?8
  13108. 88888
  13109. 8.8.8888.
  13110. guu{{
  13111. u{{{u
  13112. 5b__W
  13113. !!(!    
  13114. 2TAIL
  13115. IND 57TAIL
  13116. f===8
  13117. WZWZW
  13118. p===f
  13119. ,7,,7,,
  13120. zb"$?$$?$$z
  13121. ~k]]?~
  13122. ,,,,,,,{
  13123. {,v,v{+{v{vv{
  13124. ===;    
  13125. ==4;4==
  13126. bbs B
  13127. bbs B
  13128. bbs B
  13129. WednesdayTAIL
  13130. 35T+TXT
  13131. gWC1dayafterTAIL
  13132. gWC2daysafterTAIL
  13133. 65 / 42TAIL
  13134. 65 / 45TAIL
  13135. 56 / 52TAIL
  13136. 6VV0V66
  13137. iTV=g
  13138. VT3Ti
  13139. =!=!3!3!!!!!=!3==
  13140. $TT1    
  13141. /-H!H
  13142. As of Tuesday, December 27, 1995 TAIL
  13143. !+BiO
  13144. !data
  13145. =+TXT
  13146. =data
  13147. E+BiO
  13148. Edata
  13149. ll~l~~LC
  13150. 2/s{*
  13151. ==FH*
  13152. III-III-I-I-I
  13153. ddkdddddddd
  13154. Ydd~Y
  13155. ======d
  13156. d~Y~d
  13157. =5?>?
  13158. Z?>fY
  13159. fZfd|Z|||
  13160. ===d=d=
  13161. =d=~Y'
  13162. =Yd=~YYi
  13163. `%<+@D\??
  13164. |    ;;yr
  13165. !cbc^+3
  13166. <vDb3O?qD@%
  13167. 77777
  13168. 8HFii
  13169. DaaP-]
  13170. qTAIL
  13171. 5+BiO
  13172. 5data
  13173. C%C&y:
  13174. ZEu8a
  13175. xX&Xm822
  13176. dy%\\_gggd
  13177. XY_YXY^
  13178. YXXY_YX^
  13179. %%%\\&#
  13180. Y^^^^^Y_Y^^
  13181. Y^^^^^^
  13182. XY_Y_
  13183. %\\%#
  13184. YYYYYYYY
  13185. YYYYYYY
  13186. IIIIIIIY
  13187. IIIIIII
  13188. YHIHI
  13189. XIHIHHI
  13190. IIIId=
  13191. IIIeY
  13192. IIII==
  13193. -IIIY=
  13194. <0)Wk_
  13195. IIIIIII
  13196. IIIIIII
  13197. HII=Y
  13198. Ydddddd=
  13199. =Yddddddd
  13200. gg_g8
  13201. =<0)jS
  13202. nF='3
  13203. YYXY^^^^
  13204. 88888
  13205. 888888
  13206. Y^^Y_
  13207. 888888/-
  13208. <<<ZqkS
  13209. uuu~u
  13210. FFF9uuu
  13211. 6680`
  13212. dsF33
  13213. 3wwwl
  13214. 660XqSU
  13215. 6666666
  13216. 0V0>``
  13217. uwuwjfj
  13218. 6864X`XkkkqqqSqqqqg
  13219. mju{~888~m
  13220. Imkm.
  13221. ....8?8
  13222. 88888
  13223. 8.8.8888.
  13224. guu{{
  13225. u{{{u
  13226. 5b__W
  13227. 2TAIL
  13228. &+BiO
  13229. &data
  13230. :+BiO
  13231. :data
  13232. ;+BiO
  13233. ;data
  13234. H+BiO
  13235. Hdata
  13236. d0dxk
  13237. !T!T[!Tdx
  13238. RTk^bk9_^
  13239. Tdddd60
  13240. 59dkP_
  13241. !T0Tw
  13242. 60606kdd9dd
  13243. w!60609
  13244. ZH,U0
  13245. ^0[x!
  13246. |6dk^t
  13247.  UcZbz9
  13248. C[~ Z1Gb
  13249. d9d6k69[C
  13250. R9999
  13251. z9k999C6
  13252. ^_Pu9R6999
  13253. I+BiO
  13254. Idata
  13255. J+BiO
  13256. Jdata
  13257. c$]c!
  13258. `Iw65
  13259. `wc55
  13260. Ewq5!
  13261. K+BiO
  13262. Kdata
  13263. L+BiO
  13264. Ldata
  13265. !!wE5
  13266. !!wI`^
  13267. 55cIw
  13268. !55Nk
  13269. P+BiO
  13270. Pdata
  13271. ,6\\ff
  13272. 111717
  13273. 1111177
  13274. }hf\fffffff\\P\\f
  13275. 117177
  13276. QHHQH
  13277. (TAIL
  13278. .INFO
  13279. MidAtlanticSCRP
  13280. on openCard
  13281.   global gWCcurrCities
  13282.   global gWCmacities
  13283.   --  global gWCmacitiesInit
  13284.   global gNAVcdev
  13285.   global gWCtomorrow
  13286.   global gWC1dayafter
  13287.   global gWC2daysafter
  13288.   global gWCdate
  13289.   global gWCbtnToCityNav
  13290.   global gWCRegNav
  13291.   global gWCacceptClickDelay
  13292.   global gPathAudio
  13293.   global gWCregVoice, gWCmainmusic
  13294.   initializeCard
  13295.   put empty into gWCmacities
  13296.   put "Charleston CHS 24" into line 1 of gWCmacities
  13297.   put "Charlotte CLT 26" into line 2 of gWCmacities
  13298.   put "Chattanooga CHA 23" into line 3 of gWCmacities
  13299.   put "Lexington LEX 64" into line 4 of gWCmacities
  13300.   put "Memphis MEM 70" into line 5 of gWCmacities
  13301.   put "Paducah PAH 83" into line 6 of gWCmacities
  13302.   put "Raleigh RDU 95" into line 7 of gWCmacities
  13303.   put "Richmond RIC 96" into line 8 of gWCmacities
  13304.   put "WashingtonDC DCA 31" into line 9 of gWCmacities
  13305.   put gWCmacities into gWCcurrCities
  13306.   putinNewData (the number of this card), gWCcurrCities, 0
  13307.   --breakpoint
  13308.   --initializeCard
  13309.   -- if the isplaying of bg snd "main" is false then      
  13310.   --   set the soundFile of bg snd "main" to 
  13311.  --       (gPathAudio & gWCregVoice)
  13312.   --   play bg snd "main"
  13313.   --  end if
  13314.   put empty into gWCbtnToCityNav
  13315.   put "Region Memphis" into line 1 of gWCbtnToCityNav
  13316.   put "NextDay Charlotte" into line 2 of gWCbtnToCityNav
  13317.   put "GoBack Raleigh" into line 3 of gWCbtnToCityNav
  13318.   put "StartOver Raleigh" into line 4 of gWCbtnToCityNav
  13319.   put "Help WashingtonDC" into line 5 of gWCbtnToCityNav
  13320.   put empty into gWCRegNav
  13321.   put "NorthEast" into line 1 of gWCRegNav
  13322.   put "none" into line 2 of gWCRegNav
  13323.   put "SouthEast" into line 3 of gWCRegNav
  13324.   put "none" into line 4 of gWCRegNav
  13325.   enableNavBtn
  13326.   --ring bg alarm "alarm_loseClicks" at gWCacceptClickDelay
  13327.   start bg timer "alarm_loseClicks" expire in gWCacceptClickDelay ticks
  13328.   start bg timer "open" expire in 1 seconds  
  13329. end openCard
  13330. =GRPO
  13331. <INFO
  13332. :CARD
  13333. Cities_hilitedata
  13334. ;TAIL
  13335. Citiesdata
  13336. TAGRPO
  13337. (INFO
  13338. fCARD
  13339. Charlestondata
  13340. "TAIL
  13341. 'INFO
  13342. Richmonddata
  13343. #TAIL
  13344. #GRPO
  13345. &INFO
  13346. sCARD
  13347.     Charlottedata
  13348. %INFO
  13349. vCARD
  13350. Memphisdata
  13351.  TAIL
  13352.  TGRPO
  13353. $INFO
  13354. yCARD
  13355. Paducahdata
  13356. !TAIL
  13357. !TGRPO
  13358. Raleighdata
  13359. TGRPO
  13360. Chattanoogadata
  13361. WashingtonDCdata
  13362.     Lexingtondata
  13363. *INFO
  13364. WashingtonDCdata
  13365. r<6"D
  13366. D"66r
  13367. ]66.k
  13368. 6</!!]<6
  13369. 2J(":
  13370. r<<"D
  13371. k.."]
  13372. :Ek$($($($(
  13373. k!6<]
  13374. k.66]
  13375. 66"666
  13376. 9Jpkk
  13377. :|rak
  13378. /akkkkkkkk
  13379. 6&&&6&&&6.
  13380. .6&&&"""
  13381. "66&6".6666(6666(66]A
  13382. -]J/AA<(
  13383. (6&&"
  13384. 6&&&6
  13385. 6666666666
  13386. kkkaakkk
  13387. k.%/N
  13388. ak/]-]|
  13389. (666(
  13390. *TAIL
  13391. ,INFO
  13392. Charlestondata
  13393. !&<66
  13394. ak/-]A|
  13395. "66/!55
  13396. y77.N
  13397. N77%O?:(/    
  13398. ".">2.".
  13399. w66/A-]<6
  13400. ....y|
  13401. .$$$$6
  13402. ."&$$
  13403. $""$$
  13404. .6&&&6
  13405. /]]"""666666
  13406. "&&&6.
  13407. 6&&&6
  13408. (6&&"
  13409. 6&&&]p
  13410. A]6666
  13411. kk66]]
  13412. krEE-
  13413. wkaJU
  13414. kaE:!
  13415. .TAIL
  13416. +INFO
  13417. WashingtonDC_hilitedata
  13418. ]]6"kk
  13419. f"6<P
  13420. ]66.k
  13421. 6</!!]<<
  13422. 2J((:
  13423. -//">.;/
  13424. %`]<c6<c6<c6<wIk
  13425. `c]/c]^
  13426. !JEeJEEJ
  13427. aNaaaa
  13428. <JJw]c]c]c]c]wwI]c
  13429. ////;
  13430. xcxcxcxc
  13431. xclllUlx
  13432. 6<kw6<
  13433. ;/;/<%
  13434. a.%6W
  13435. k66<]!]]]9|]J7|6!
  13436. akakkkk
  13437. npJJ|zpr
  13438. !'-/$9
  13439. aE--9-:UJrk
  13440. aal./]P]P]J!
  13441. 4TAIL
  13442. 4T+BiO
  13443. -INFO
  13444. Charleston_hilitedata
  13445. 66]/!]66
  13446. aE--9-:
  13447. /$$$'
  13448. $$$$<'
  13449. //;//
  13450. ]<6!k
  13451. p]6!kk
  13452. p$-Apa
  13453. -pakpJ
  13454. A]akarJ
  13455. -J$kNa8
  13456. 2TAIL
  13457. 2TAI+BiO
  13458. .INFO
  13459. Richmonddata
  13460. {......
  13461. 25551
  13462. 1111141
  13463. 1111111115
  13464. 1111115
  13465. 21515
  13466. k!6<]
  13467. kaEEO
  13468. +TAIL
  13469. +TAIL+BiO
  13470. /INFO
  13471. Richmond_hilitedata
  13472. kk!<]]
  13473. e]IUe]]A
  13474. }E9p8
  13475. $$$$$$$
  13476. 0$$$$0
  13477. //////;
  13478. rrrrr
  13479. ]]]`P
  13480. 0INFO
  13481. Raleighdata
  13482. l7&&&/]
  13483. :E|EEE$a
  13484. akkkk
  13485. awJ]6!aaa
  13486. a|--]/
  13487. ".".2.".
  13488. -/$/--
  13489. 07245
  13490. 6666$
  13491. $&"""
  13492. (6&&&6666$
  13493. ,,4661
  13494. $0$$$$
  13495. :4:22
  13496. .<.0PPN
  13497. +?JLt`-&,
  13498. ..PPN
  13499. +8115
  13500. )))---
  13501. (77777
  13502. GTAIL
  13503. 1INFO
  13504. Raleigh_hilitedata
  13505. 7EEEr
  13506. kk.6]]
  13507. /,m!{x
  13508. ,\i{n
  13509. ,ib{h%.>0
  13510. w%<6A
  13511. kk$EjJ
  13512. *(m\bk
  13513. $$$$$$
  13514. $$$$${
  13515. $$$$$
  13516. 3=iq~u
  13517. //////////
  13518. 6666$
  13519. ,L,,,,,,,,
  13520. E{Ic]c
  13521. $$$$$$$$$
  13522. :4:22
  13523. k.66]
  13524. 77 57
  13525. QTAIL
  13526. 2INFO
  13527.     Charlottedata
  13528. f777Q
  13529.     7E5E
  13530. rprprk
  13531. y777N
  13532. N777y
  13533. k7777
  13534. !!!!!
  13535. 6-$$$;`N
  13536. 3y`.y
  13537. 999Ek
  13538. fffud~f
  13539. s]W]$
  13540. WW]WWWWWW
  13541. dndnwOO
  13542. hjLJ?Lg442J&
  13543. -4!!!
  13544. <+!!5<'!!!+4
  13545. FFFFFFFWWWW_bbsbsssszzzszzzzzzzzxzzxx
  13546. 55$5$
  13547. 2TAIL
  13548. 3INFO
  13549. Charlotte_hilitedata
  13550. kkE|5
  13551. IwIcIk
  13552. !6666
  13553. JJ4AgJ
  13554. 55$5$
  13555.     ''''=
  13556. =TAIL
  13557. =+BiO
  13558. 4INFO
  13559.     Lexingtondata
  13560. 33DFll5>%%
  13561.     '    %    
  13562. %%%%'.
  13563. .''%''
  13564. www}w
  13565. S4PAAPk
  13566. {xbkh
  13567. 3-333333333
  13568. D3DDDFDFFFFFFWFFWF
  13569. !F>.Xaggd.
  13570. r--'-dF444444444A
  13571. 4!RRR
  13572. wuuw}
  13573. WWWWWFWWWWW
  13574. 555558
  13575. -<<66666666666666666666<
  13576. 6&&&6
  13577. "6666(6666(
  13578. ${D`..,DLU
  13579. k.(IJJeJeJP
  13580. aaa%aNkfk
  13581. |!/|ra
  13582. 7TAIL
  13583. ?+BiO
  13584. 5INFO
  13585. Lexington_hilitedata
  13586. wull5>%%
  13587.     '    %    
  13588. %%%%'.
  13589. .''%''
  13590. www}w
  13591. E!2kRY5!k
  13592. {o///
  13593. ^rP44444444
  13594. wuwww
  13595.     FFFFFFFD
  13596. KKKKKI
  13597. bWWb55
  13598. 555555
  13599. s_D-@
  13600. ]66.k
  13601. k.(IJJeJeJP
  13602. aaa%aNkfk
  13603. 6INFO
  13604. Chattanoogadata
  13605. kaE8!
  13606. aNk8]]rAA!
  13607. !--A-|a
  13608. --$$3|
  13609. :EOkkaa
  13610. y777N
  13611. }<<]AA]66wk
  13612. b&N&,
  13613. Na/aNr
  13614.     ADIfIfIf]
  13615. $$<w    $
  13616. .$$$2"
  13617. $($$$$$$$
  13618. !!!!!
  13619. 868668
  13620. ~~u~~~u
  13621. 'A4#fuu
  13622. ......sJJJJssdrdr]_J_J]]JJJJ]]S
  13623. ~JJ4A
  13624. mJ44J5
  13625. !^##J4J4A4JAJAS]4A'4Jm~kJ+'+JS
  13626. ]4A'4S#V
  13627. 8kSSk
  13628. }SSa.
  13629. ..;....;.....
  13630. .....
  13631. .;.E!
  13632. SdnryY
  13633. 8^S^S
  13634. .s]s]
  13635. zsss    
  13636. 5TAIL
  13637. 7INFO
  13638. Chattanooga_hilitedata
  13639. kkDrN!
  13640. kkJEe<
  13641. kaE8!
  13642. JE$aa
  13643. A<<!w
  13644. bbN&,`
  13645. ``L$`
  13646. -AAAA
  13647. N<<c<@z<
  13648. $$$$$$$$$$$$
  13649. 686666
  13650. 86666
  13651. ~~~u~
  13652. A!--X88-X>
  13653. $555555
  13654. 55555
  13655. s|zs|s|F
  13656. |||zsszsss
  13657. 8INFO
  13658. Paducahdata
  13659. ~u~~~
  13660. $55,w
  13661. 555555
  13662. !!!!!
  13663. ?55?5$?
  13664. CA'AA'4J
  13665. SA'4AS
  13666. $3'!RRRR+
  13667. 'A'4r
  13668. '+'+'+'+'I
  13669. J'+'+'aS+'+J
  13670. -RRR!+
  13671.     ||||||||
  13672. udddbbb$~+
  13673. :I.6666(6666(
  13674. a%k8]-
  13675.                         
  13676. r<66D
  13677.                     
  13678. *TAIL
  13679. *TAIL
  13680. 9INFO
  13681. Paducah_hilitedata
  13682. =5555
  13683. -uJ5555555
  13684. 55555
  13685. ,7@J_D3
  13686. qP44AAAAr
  13687. P(F444N
  13688. F4!RRRR+
  13689. AA]]2
  13690. AAN]P]]DI
  13691. r]]P]]3|P]]r
  13692. +RRR!A!%R+
  13693. E6+++
  13694. r<66D
  13695. ay77VN
  13696. r<66D
  13697.                         
  13698.                                 
  13699.                                 
  13700.                                     
  13701.                             
  13702. 4TAIL
  13703. :INFO
  13704. Memphisdata
  13705. I-'-!!
  13706. NNNby
  13707. .syyU
  13708. kkkkkkkka
  13709. pppprrrEO$$
  13710. aaakkkkkkkkka
  13711. Odud!
  13712. <<>...
  13713. COdr'!
  13714. -]PNP]]]]]]]$&&
  13715. 666666
  13716. ~SSS-8&SSk~
  13717.                             
  13718. &UUku
  13719.                                 1
  13720. gngw    
  13721. }F}O;
  13722. hqqnnnw    
  13723. ;;;;;;;;
  13724. .TAIL
  13725. .T+BiO
  13726. ;INFO
  13727. Memphis_hilitedata
  13728. ]]]]]]]
  13729. ]c]c]c
  13730. ]-//=
  13731. _dd_;;;
  13732. zzzzzzzzzzz
  13733. Paducah_icondata
  13734. H!33H
  13735. Memphis_icondata
  13736. HH!H!H
  13737. Lexington_icondata
  13738. H!33H
  13739. Chattanooga_icondata
  13740. $TT1    
  13741. /-H!H
  13742. WashingtonDC_icondata
  13743. H!33H
  13744. Charleston_icondata
  13745. $TT1    
  13746. /-H!H
  13747. Richmond_icondata
  13748. NAME+BiO
  13749. Raleigh_icondata
  13750. Cha+TXT
  13751. Paducahdata
  13752. 63/41ADDD
  13753. ---+TXT
  13754. Memphisdata
  13755. 63/45ADDD
  13756. ityco+TXT
  13757.     Lexingtondata
  13758. 60/35ADDD
  13759. tto+TXT
  13760. WashingtonDCdata
  13761. 60/36ADDD
  13762. Chattanoogadata
  13763. 66/46ADDD
  13764. Charlestondata
  13765. 83/55ADDD
  13766. --+TXT
  13767. Richmonddata
  13768. 61/35ADDD
  13769. Raleighdata
  13770. 69/37ADDD
  13771.  name+BUT
  13772. !INFO
  13773. PaducahSCRP
  13774. on mouseUp
  13775.   cityButtonPush (the short name of me)
  13776. end mouseUp
  13777. -------------------------
  13778. on mouseDown
  13779.   cityButtonDown (the short name of me)
  13780. end mouseDown
  13781. -------------------------
  13782. on mouseLeave
  13783.   cityButtonLeave (the short name of me)
  13784. end mouseLeave
  13785. citycode
  13786. downcity
  13787. Memphis
  13788. leftcity
  13789.     rightcity    Lexington
  13790. upcity
  13791. ityButtonDow+BUT
  13792.  INFO
  13793. MemphisSCRP
  13794. on mouseUp
  13795.   cityButtonPush (the short name of me)
  13796. end mouseUp
  13797. -------------------------
  13798. on mouseDown
  13799.   cityButtonDown (the short name of me)
  13800. end mouseDown
  13801. -------------------------
  13802. on mouseLeave
  13803.   cityButtonLeave (the short name of me)
  13804. end mouseLeave
  13805. citycode
  13806. downcity
  13807. Button Region
  13808. leftcity
  13809.     rightcity
  13810. Chattanooga
  13811. upcity
  13812. PaducahTAIL
  13813. <+BUT
  13814. WashingtonDCSCRP
  13815. on mouseUp
  13816.   cityButtonPush (the short name of me)
  13817. end mouseUp
  13818. -------------------------
  13819. on mouseDown
  13820.   cityButtonDown (the short name of me)
  13821. end mouseDown
  13822. -------------------------
  13823. on mouseLeave
  13824.   cityButtonLeave (the short name of me)
  13825. end mouseLeave
  13826. citycode
  13827. downcity
  13828. Richmond
  13829. leftcity    Lexington    rightcity
  13830. Button Help
  13831. upcity
  13832. Button HelpTAIL
  13833.     LexingtonSCRP
  13834. on mouseUp
  13835.   cityButtonPush (the short name of me)
  13836. end mouseUp
  13837. -------------------------
  13838. on mouseDown
  13839.   cityButtonDown (the short name of me)
  13840. end mouseDown
  13841. -------------------------
  13842. on mouseLeave
  13843.   cityButtonLeave (the short name of me)
  13844. end mouseLeave
  13845. citycode
  13846. downcity
  13847. Chattanooga
  13848. leftcity
  13849. Paducah    rightcity
  13850. Charleston
  13851. upcity
  13852. "INFO
  13853. CharlestonSCRP
  13854. on mouseUp
  13855.   cityButtonPush (the short name of me)
  13856. end mouseUp
  13857. -------------------------
  13858. on mouseDown
  13859.   cityButtonDown (the short name of me)
  13860. end mouseDown
  13861. -------------------------
  13862. on mouseLeave
  13863.   cityButtonLeave (the short name of me)
  13864. end mouseLeave
  13865. citycode
  13866. downcity    Charlotte
  13867. leftcity    Lexington    rightcity
  13868. Richmond
  13869. upcity
  13870. WashingtonDCTAIL
  13871. ---+BUT
  13872. RaleighSCRP
  13873. on mouseUp
  13874.   cityButtonPush (the short name of me)
  13875. end mouseUp
  13876. -------------------------
  13877. on mouseDown
  13878.   cityButtonDown (the short name of me)
  13879. end mouseDown
  13880. -------------------------
  13881. on mouseLeave
  13882.   cityButtonLeave (the short name of me)
  13883. end mouseLeave
  13884. citycode
  13885. downcity
  13886. Button GoBack
  13887. leftcity    Charlotte    rightcity
  13888. upcity
  13889. RichmondTAIL
  13890. --------------+BUT
  13891. #INFO
  13892. RichmondSCRP
  13893. on mouseUp
  13894.   cityButtonPush (the short name of me)
  13895. end mouseUp
  13896. -------------------------
  13897. on mouseDown
  13898.   cityButtonDown (the short name of me)
  13899. end mouseDown
  13900. -------------------------
  13901. on mouseLeave
  13902.   cityButtonLeave (the short name of me)
  13903. end mouseLeave
  13904. citycode
  13905. downcity
  13906. Raleigh
  13907. leftcity
  13908. Charleston    rightcity
  13909. Button Help
  13910. upcity
  13911. WashingtonDCTAIL
  13912. Charlotte_icondata
  13913. $TT1    
  13914. /-H!H
  13915.     Charlottedata
  13916. 71/43ADDD
  13917.     CharlotteSCRP
  13918. on mouseUp
  13919.   cityButtonPush (the short name of me)
  13920. end mouseUp
  13921. -------------------------
  13922. on mouseDown
  13923.   cityButtonDown (the short name of me)
  13924. end mouseDown
  13925. -------------------------
  13926. on mouseLeave
  13927.   cityButtonLeave (the short name of me)
  13928. end mouseLeave
  13929. citycode
  13930. downcity
  13931. Button NextDay
  13932. leftcity
  13933. Chattanooga    rightcity
  13934. Raleigh
  13935. upcity
  13936. CharlestonTAIL
  13937. ChattanoogaSCRP
  13938. on mouseUp
  13939.   cityButtonPush (the short name of me)
  13940. end mouseUp
  13941. -------------------------
  13942. on mouseDown
  13943.   cityButtonDown (the short name of me)
  13944. end mouseDown
  13945. -------------------------
  13946. on mouseLeave
  13947.   cityButtonLeave (the short name of me)
  13948. end mouseLeave
  13949. citycode
  13950. downcity
  13951. Button NextDay
  13952. leftcity
  13953. Memphis    rightcity    Charlotte
  13954. upcity    LexingtonTAIL
  13955. =INFO
  13956. Help_Touchdata
  13957. RuA{    
  13958. D27Rc
  13959. RuAg^
  13960.  tgAV
  13961. Pq/=76
  13962. co0?S
  13963.     5677
  13964.     2577
  13965. 7(((    (((>
  13966. ((((((((
  13967. &(((>
  13968. 3(((3
  13969.     2557
  13970. {At,R
  13971. 6Ruto
  13972. =//=?
  13973. A21&c
  13974. t>k31
  13975. b21&o
  13976. co0?S
  13977. ]    &C9
  13978. {%9bB
  13979. ((((((((
  13980. 6666M
  13981. {{{t[wwK
  13982.         2567
  13983. 5??        
  13984. 66666
  13985. ((-J}}i
  13986. }}U<9(
  13987. ((<J}}
  13988. j}}l?((
  13989. J}}}6
  13990. 9(<[}}Q
  13991. }l?((
  13992. J}}}}|||6
  13993. ((>lUUUU}}k9
  13994. i}EUUUUD<((
  13995. P~K}-
  13996. ((<[}}i
  13997. k}}J>((
  13998. G9~(~9G
  13999. s\HK8!567
  14000. <=<=&
  14001. SSSSSS
  14002. 28-5E
  14003. OG2Kuy4
  14004. J!''!
  14005. 6K6c6
  14006. GFSSSSSSSSSSSSSS
  14007. 4"9>II}Y
  14008. }M{%Y.
  14009. _IIQ#4
  14010. ^``uuuuuuuuuuuuuu
  14011. 4)i>^>
  14012. rcYe    MP
  14013. SP(SSQc
  14014. 1'4p4
  14015. x(g7rg6w?8
  14016.         256
  14017. &q:(((:6,75*
  14018. 9&<5od
  14019. ?>?>>?>?>>?>?>?;
  14020. TfRNuuWrftJnsk|hh~srXu
  14021. Ri.i-
  14022. o(~XZ~XZ~XZ~XZ
  14023. $LN~ZX~ZX~ZX(~
  14024.         ?277
  14025. 9(<l}}Q9
  14026. 9(}cD
  14027. kE}J>((
  14028.         2267
  14029. CBCBCCC@@@@@@CCCC@@C@@@@@@@@@@C@C
  14030. ((>l}}
  14031. 8'(GiAy
  14032. 9j}}l?9(
  14033. vm~(&
  14034. ((>J}}
  14035. 8i}}U<9(
  14036. ((<}}}i
  14037. }l?((
  14038. ((.J}
  14039. }}J>((
  14040. ((>U}}k
  14041. mmmmmlmmlml2l5l2555
  14042. mmmmlmlml2l5l25555
  14043. mmmmmlmlml2l2l25555
  14044. mmmmmml|mlmlml2l2l#l555555555$55555$55$555555$5555555$5555
  14045. Y=?45
  14046. =445    
  14047. ^Y_YYY_Y
  14048. =?44    
  14049. =445    
  14050. XYXYY
  14051. YXYYYY
  14052. XYXYXYXXYXY
  14053. Y^^YXY^^
  14054. Y^^^^
  14055. ?5677
  14056. YXXXY
  14057. ?5567
  14058. HHIHH
  14059. SSSSSSSSSSSSSSSS
  14060. ^uuuuuuuuuuuuuuuu
  14061. eII---
  14062. edddde
  14063. ?=^^==d
  14064. =d=dd
  14065. =:^XY
  14066. >?>?>?>?>?>?>??
  14067. Y^YXX
  14068. 4RSRg
  14069. 6RSXe
  14070.         2577
  14071.         2577
  14072. _Y^^^
  14073. 6.m]X
  14074. XYXY_
  14075. _YXXY^^^^
  14076. 7662            
  14077. 7652    
  14078. 56666665
  14079. *+**?
  14080. }JUUUUUUUUUUUUUUUUUJUJJJJJJJJ
  14081. XXXXN
  14082. GGXNNQNXNXXXXX
  14083. XXXXX
  14084. X6XnXN
  14085. XXXXX
  14086. XXnXX
  14087. XXXnX
  14088. SSSSSSSSSSSSSSSS
  14089. Kuuuuuuuuuuuuuuuu
  14090. *+*+:(
  14091. UJUJU
  14092. QXQfx)(>(
  14093. >QQX\tky&33
  14094. >>346    >??>?>>
  14095. >?>?>?>?>>?>?>?;
  14096. GNQX-;:,
  14097.     ?257
  14098. GQGN-:,:
  14099.         2577
  14100. JJJGXNXQ
  14101. Gy6Ny
  14102. QXGQ)>,:B
  14103.         2577R'&x`'&x3
  14104. yu'7x3
  14105. F&&"u&&33
  14106. XNfnXXfN
  14107. XNNXn
  14108. XGGGG
  14109. XXXXXXX
  14110. XXXXXXXXXXXX
  14111. =<%jjt,t,t,t,vtvtvtvt,tt,t,t,t,t,t,v,t,,t,,v,.:;
  14112. >=)??<
  14113. )>mn+1lv
  14114. 77>(/
  14115. /(9>>(
  14116. (>>(9&?x.'
  14117. ??((?
  14118. ?((44((:%((:
  14119. 3(:/3)
  14120. >((7>
  14121. >&((/    ?x.'
  14122. 0??-(
  14123. >9:    .(
  14124. >(9>>((>
  14125. A7>((
  14126. 9(((((((
  14127. &&7&&7~
  14128. &&<=<&<=<&
  14129. <&<=<&
  14130. <&<=<&
  14131. &&97&&
  14132. Y7d^>v
  14133. ~~o~~~o
  14134. ~&~7~~
  14135. ~~o~X~X
  14136. 99999
  14137. 99&9&&
  14138. &X&~o
  14139. &BKg|>&
  14140. X&&&~X
  14141. ><=<7
  14142. }JlZ7Bh@|
  14143. ~&7~&
  14144. &X&&~~XZ
  14145. <=<7666
  14146. io&&&X
  14147. &999&&
  14148. 7dA$|
  14149. d9&XX
  14150. f7B7_
  14151. f,N&'
  14152. >3477
  14153. o&&7&
  14154. &=&<5
  14155. <=&<<
  14156. ~o~&p
  14157. SSSSSSSSWSSSSSSS
  14158. Wuuuuuuuu`uuuuuuu
  14159. ~o~&X
  14160. )o&&o~
  14161. `&&\7
  14162. Xg||$=
  14163.         2577
  14164. &9&9&&&~
  14165. >?>?>?>?>>?>?>?>k&O
  14166. >2<=<
  14167. &7&&&&
  14168. ~o|AZ
  14169. &=&&<=
  14170. R3<((
  14171. >%<((%
  14172. 3(((3((%<((%
  14173. (((3(
  14174. (((    (
  14175. (3(()
  14176. =((?>((>?((
  14177. (>?((
  14178. (((((
  14179. ((977(.
  14180. ~&&&X
  14181. 'o~~'
  14182. =<<44
  14183.         ?277
  14184. *+*+:(
  14185. }5}lKmHX
  14186. X7~Xo~X~
  14187. &=<&=<&<=
  14188. ?>>>3477
  14189.         2267
  14190. ((((((((
  14191. 7652        
  14192. 988^^
  14193. ^^9^x^
  14194. =>            
  14195. =''='=='==
  14196. dGY'=d]
  14197. `d='=
  14198. ~]d''=~
  14199. ]='='
  14200. ??<267
  14201. B==''
  14202. e0$>=
  14203. SSSSSSSSSSSSSSSS
  14204. vdY^'8
  14205. Wuuuuuuuuuuuuuuuu
  14206. `&&\7
  14207. ^^Yn0
  14208.     c:9^^Y    
  14209. ^$2~Y?
  14210. n34of`^|0Y^
  14211. "Z:n 
  14212. [8&_~0}^^'_|["9_
  14213. _9_9^[|_
  14214. fo`_^
  14215. >?>?>?>?>>?>?>?>k&O
  14216. 8_9X^'^g^^g
  14217. _9_'^8X^
  14218. ^8_&_
  14219. ^8_9_8^
  14220. _9_8_
  14221. 8_8^9
  14222. 8_9_8^~=
  14223. ^8_'^
  14224. `X`X`X~X `X]
  14225. `e` Y
  14226. ]X]X`:
  14227. Y`X]X`:
  14228. 7R&&&
  14229. [Za^S
  14230. kSRSkQkQkQkRRk
  14231.     2257
  14232. S7&x`'&x"
  14233. 7&33&&33
  14234. ce`;;#
  14235. &&((&&((
  14236. W&&>W&
  14237. u&&&S
  14238. &&((&&((
  14239. (&&((
  14240. >&&(7
  14241. &&((&`
  14242. {|kmFkp
  14243. &&(9&&((
  14244. (&&9(
  14245. (&7((
  14246. &&((&u
  14247. <9&&<(
  14248. {g(:Be
  14249. 15567
  14250. 9%$34477
  14251. *+**?
  14252. 12257
  14253. P9sE9
  14254.         2577
  14255. rj{,62
  14256. =<;78
  14257. N**;d
  14258.     5567
  14259. ^^g99999(wNM\5D
  14260. ^X***r
  14261. 9oNMM
  14262. {{OA++AP7
  14263. 9gg^|
  14264. &&33'Q
  14265. hD'&i3
  14266. BM{P+
  14267. B{RBBi
  14268. {ig7^^
  14269. W&&&q
  14270. SSSSSSSSSSSSSSSW
  14271. R''&&&&&u
  14272. &7&&&&
  14273. 7('&&79(3
  14274. *+*+:
  14275. 9$Q#M
  14276. DLQQ    
  14277. aja1^
  14278. {Bs^!D3
  14279. >?>?>?>?>>?>?>?;
  14280. 7S&&&
  14281. X3DDIw
  14282. 99P9ii
  14283. 7(((    (({
  14284. &(((>
  14285. k&&&M
  14286. B&&&u
  14287. >&&(&
  14288. >&&(7
  14289. 9>+,33#32
  14290. ivt!!.$<=3=
  14291. <393%3
  14292. &&((&&
  14293. &7((7&
  14294. (&&((
  14295. (&7{Y
  14296. 3<(>>((7>
  14297. >&((&        
  14298. :)3>>
  14299. 77>(>
  14300. >((>>(
  14301. (>>(9&?x.'
  14302. ((?3(
  14303. :(:    ?    4
  14304. )>>((>
  14305. ((77    
  14306.     ((:7
  14307. :(:    ?    4
  14308. <;;2<
  14309. )>>)%
  14310. >?9???(?
  14311. >(((    (((7
  14312. 3(((3
  14313. >(((7
  14314. 4>?>>>347
  14315. ;+*+:
  14316.         2267
  14317.         2577
  14318.     2257
  14319.     2257
  14320.     2567
  14321. *+*+:(
  14322. 77777
  14323. 67777
  14324. >INFO
  14325. Help_Remotedata
  14326. RuA{    
  14327. XzRuAg^    
  14328. RuAg^    
  14329. RuA{    
  14330. {uA9c
  14331.     5577
  14332. )(%B}
  14333.     2557
  14334.     2557
  14335. 3(((3
  14336. (>34477
  14337. RuAgbo
  14338.     5577
  14339. 8S3%8S34
  14340. 0"*813
  14341. cSbZi
  14342. <%X/1
  14343. =//=>
  14344. A21&c
  14345. )?(z*
  14346. 6666666666666
  14347. (((?((9>
  14348.         2567
  14349. 66666
  14350. (((((9((
  14351. (9(((((9
  14352. ((<J}}i
  14353. }}U<((
  14354. *+**?(
  14355. ((<J}}
  14356. j}}l.((
  14357. J}}}6
  14358. (9<J}}Q
  14359. }l?((
  14360. J}}}7
  14361. ((>l}}k9
  14362. i}}U-((
  14363. P~K}-
  14364. (9<J}}i
  14365. k}}J>(9
  14366. PJKK-766
  14367. ((<l}Ei
  14368. Q}EJ-((
  14369. G9~(~9G
  14370. s\HK8!567
  14371. <=<=&
  14372. SSSSSS
  14373. 28-5E
  14374. Ss?Q=
  14375. S==SS
  14376. es?S=
  14377. uBBH=    ?557
  14378. J!''!
  14379. 6K6c6
  14380. GFSSSSSSSSSSSSSS
  14381. 4"9>II}Y
  14382. }M{%Y.
  14383. _IIQ#4
  14384. ^``uuuuuuuuuuuuuu
  14385. 4)i>^>
  14386. rcYe    MP
  14387. SP(SSQc
  14388. 1'4p4
  14389. g7rg6w?8
  14390.         256
  14391. &q:(((:6,75*
  14392. 9&<5od
  14393. ?>?>>?>?>>?>?>?;
  14394. TfRNuuWrftJnsk|hh~srXu
  14395. Ri.i-
  14396. o(~XZ~XZ~XZ~XZ
  14397. $LN~ZX~ZX~ZX(~
  14398.         ?277
  14399. 9(<l}}Q9
  14400. 9(}cD
  14401. kE}J/((
  14402.         2267
  14403. 7523    
  14404. 9(<J}}i
  14405. !coQ9
  14406. }J/((
  14407. ((>l}}
  14408. 8'(GiAy
  14409. 9j}}l?((
  14410. vm~(&
  14411. (9<l}}i
  14412. }l?((
  14413. ((?J}
  14414. }}J/((
  14415. *+**?(
  14416. ((>UUUU
  14417. k}}UUUU
  14418. *+*++
  14419. Y:,55
  14420. ^^XY^
  14421. ^Y_YYY_Y
  14422. =?44    
  14423. =444    
  14424. =444    
  14425. =444    
  14426. =444    
  14427. Y^^^XXY^^^
  14428. ^^^^^YXY^^Y
  14429. XY_YXY^
  14430. Y^^^YXY_Y
  14431. XY^^^^^
  14432. YXY^^^^YX
  14433. ^^^Y_YX
  14434. Y^^^^
  14435. YYYXY
  14436. HHIHH
  14437. SSSSSSSSSSSSSSSS
  14438. ^uuuuuuuuuuuuuuuu
  14439. eII---
  14440. edddde
  14441. ?=^^==d
  14442. =d=dd
  14443. =:^XY
  14444. >?>?>?>?>?>?>??
  14445. 4    SRSZ
  14446. XXXYY
  14447. 5RSRg
  14448.     ?257
  14449.     ?257
  14450. 53(>(
  14451. (((43(((    
  14452. ((:&7:(9
  14453.     (9(3
  14454. ((    (((>
  14455. ((    (((/7:(9
  14456.     (((3
  14457. ((>?(9    (?
  14458. 4RSRg
  14459. 6RSXe
  14460.         2577
  14461.         2577
  14462. _Y^^^
  14463. 6.m]X
  14464. XYXY_
  14465. _YXXY^^^^
  14466. 7??_SR
  14467. RQRRQ
  14468. 66.[X
  14469. SRSRRRRRSRRSRRQRS
  14470. RRQRQ
  14471. 7652    
  14472. 56666665
  14473. }JUUUUUUUUUUUUUUUUUJUJJJJJJJJ
  14474. XXXXN
  14475. GGXNNQNXNXXXXX
  14476. XXXXX
  14477. X6XnXN
  14478. &&&>&&&>
  14479. >&7C>39
  14480. d&&ud&
  14481. u((&&((
  14482. &&&&&C
  14483. XXnXX
  14484. XXXnX
  14485. SSSSSSSSSSSSSSSS
  14486. nXXXX
  14487. QNGf2:&
  14488. R&&&u
  14489. (&&((
  14490. ::!=        2577
  14491. '&-/'
  14492. >?>?>?>?>>?>?>?;
  14493.         2477
  14494. ((:74<((
  14495.     /((7
  14496. >9((    
  14497. (    ((%
  14498. >(((    (
  14499. )((    9(
  14500. (((((9(
  14501. GNQX-;:,
  14502.     ?257
  14503. GQGN-:,:
  14504.         2577
  14505. JJJGXNXQ
  14506. Gy6Ny
  14507. QXGQ)>,:B
  14508.         2577R'&x`'&x3
  14509. yu'7x3
  14510. F&&"u&&33
  14511. GQQN$>;:
  14512.     ?257
  14513. 9&&((
  14514. XNNXn
  14515. XGGGG
  14516. XXXXXXX
  14517. XXXXXXXXXXXX
  14518. =<%jjt,t,t,t,vtvtvtvt,tt,t,t,t,t,t,v,t,,t,,v,.:;
  14519. >=)??<
  14520. )>mn+1lv
  14521. 77>(/
  14522. /(9>>(
  14523. (>>(9&?x.'
  14524. ??((?
  14525. ?((44((:%((:
  14526. 3(:/3)
  14527. >((7>
  14528. >&((/    ?x.'
  14529. 0??-(
  14530. >9:    .(
  14531. >(9>>((>
  14532. A7>((
  14533. 9(((((((
  14534. &&7&&7~
  14535. &&<=<&<=<&
  14536. <&<=<&
  14537. <&<=<&
  14538. &&97&&
  14539. Y7d^>v
  14540. ~~o~~~o
  14541. ~&~7~~
  14542. &X@gZ$
  14543. X~Xo&X
  14544. &9&7&&
  14545. &BKg|>&
  14546. X&&&~X
  14547. ><=<7
  14548. }JlZ7Bh@|
  14549. ~&7~&
  14550. &X&&~~XZ
  14551. <=<7666
  14552. io&&&X
  14553. &999&&
  14554. 7dA$|
  14555. d9&XX
  14556. >7BA5<
  14557. 9?=    2577
  14558. o&&7&
  14559. &=&<5
  14560. <=&<<
  14561. ~o~&p
  14562. SSSSSSSSWSSSSSSS
  14563. Wuuuuuuuu`uuuuuuu
  14564. ~o~&X
  14565. )o&&o~
  14566. lJk~g|
  14567.     ?25/
  14568. 7^M37^
  14569. S&&xl&&
  14570. &7((7&
  14571. 8X&u)
  14572. &&((&
  14573. 'V&u)
  14574. io~&X
  14575. ~&~X~&
  14576. &9&9&&&~
  14577. >?>?>?>?>>?>?>?>k&
  14578. >2<=<
  14579. &7&&&&
  14580. ~X~7~Bh$&=&&
  14581. X&&7&&
  14582. &&&X~$
  14583. ~&&&X
  14584. 'o~~'
  14585. =<<44
  14586.         ?277
  14587. X&~&7~9
  14588. &&9&G
  14589. X~o~o~X~m~BhgZgg|ZZK%v
  14590. $Z$?$
  14591.         2267
  14592. ((((((((
  14593. 7652        
  14594. ^^&Y^Y
  14595. =?            6
  14596. %        66
  14597. 88^'d
  14598. ]=='=
  14599. ]'='=d
  14600. &??5567
  14601. B=d'=
  14602. SSSSSSSSSSSSSSSS
  14603. Wuuuuuuuuuuuuuuuu
  14604. 63n:Y
  14605. B!>dB
  14606. `&&\7
  14607. Z*>5=
  14608. e&_^~    &_
  14609. =|^^O2
  14610. 88X n
  14611. o0f^^h0Y
  14612. Y[7X4|XZ0
  14613. _&_|0
  14614. '^[o6o]_&_
  14615. ^f|^io^9_
  14616. >?>?>?>?>>?>?>?>k&
  14617. ^Y^g^
  14618. _9_9_
  14619. 8_9:d
  14620. ^8^^9_
  14621. ^gYX9X9
  14622. XY`X]^`e
  14623. `XY`e`Y`eY
  14624. `X`e`:d
  14625. __98'_9_
  14626. Y'''Y
  14627. ''=d'=
  14628. 7R&&&
  14629. gnmbY^f\
  14630. kStS]
  14631. 7752        
  14632.     2257
  14633. S7&x`'&x"
  14634. 7&33&&33
  14635. B7&&d
  14636. W&&&q
  14637. O'7&i
  14638. [->=v
  14639. W&&>W&&>
  14640. u&&&S
  14641. &&((&&((
  14642. (&&((
  14643. >&&(7
  14644. &&((&`
  14645. {|kmFkp
  14646. &&(9&&((
  14647. (&&9(
  14648. (&7((
  14649. &&((&u
  14650. &&99'&n
  14651. <9&&<(
  14652. p988H
  14653. 15567
  14654. {$34477
  14655. 42567
  14656. "    2577
  14657. 12257
  14658. C^^g99
  14659. ^ACz$ZBmw:
  14660.         2577
  14661. N**;d
  14662.     5567
  14663. *+*+:(
  14664. 99gg^
  14665. NwttB
  14666. z4477
  14667. 9^X***r
  14668. 9oNMM
  14669. N89(v{$
  14670. {{OA++AP7
  14671. 9gg^|
  14672. &&33'Q
  14673. hD'&i3
  14674. {M{P+
  14675. B{RBBi
  14676. {ig7^^
  14677. W&&&q
  14678. SSSSSSSSSSSSSSSW
  14679. C^w7[#
  14680. S&&&u
  14681.     &&70
  14682. 6&&(&
  14683. DL7@    
  14684. >?>?>?>?>>?>?>?;
  14685. 77651"
  14686. 9xM~G
  14687. "(((3((%<((%
  14688. (((7(((3(
  14689. ((    (((>
  14690. (((33(((    
  14691. )((    (
  14692. ((3<((
  14693. 4(>3(((
  14694. 7S&&&
  14695. +.'^g
  14696. X3DDIw
  14697. 7(((    (({
  14698. &(((>
  14699. 9!N))
  14700. :"{99
  14701. >&&(&
  14702. >&&(7
  14703. 9>+,33#32
  14704. ivt!!.$<=3=
  14705. <393%3
  14706. &&((&&
  14707. &7((7&
  14708. (&&((
  14709. (&7{Y
  14710. >?9???(?
  14711. >(((    (((7
  14712. 3(((3
  14713. >(((7
  14714.     0257
  14715.         2577
  14716.     2257
  14717. e)+BiO
  14718. CINFO
  14719. Help_BackToMap_hilitedata
  14720. >(()K
  14721. K=((>
  14722. :[[Fa
  14723. dYY==d
  14724. =='=d
  14725. u63Z=Y
  14726. 9/%Y4=%
  14727. 9~Y70
  14728. Y3?d^
  14729. ^x^^&2
  14730. -_    5%
  14731. 2|^^O 
  14732. oY^^i0
  14733. ^Y[n6[
  14734. YoZ^^
  14735. 0|_'^
  14736. Z4o0]
  14737. fo^9^Krd^[_
  14738. 8_8_9
  14739. ^9^^^`X
  14740. YOX`}X~XY`
  14741. Y`X]^
  14742. X `e`e`e
  14743. *TAIL
  14744. DINFO
  14745. Help_BackToMapSCRP
  14746. on mouseUp
  14747.   global gWChilitedBtn
  14748.   global gNAVcdev
  14749.   global gWCcd_or_bg
  14750.   --  global gNAVEpcotPath
  14751.   global gWCpath
  14752.   global gWCvoicePath
  14753.   global gWCmainMusic
  14754.   global gpathAudio
  14755.   clearIdleAlarm
  14756.   play stop
  14757.   send mouseLeave to cd btn (the short name of me)
  14758.   send mouseDown to cd btn (the short name of me)
  14759.   send mouseLeave to cd btn (the short name of me)
  14760.   send mouseDown to cd btn (the short name of me)
  14761.   send mouseLeave to cd btn (the short name of me)
  14762.   lock screen
  14763.   if gNAVcdev is "REMOTE" then
  14764.     hide cd bmp "Help_Remote"
  14765.   else
  14766.     hide cd bmp "Help_Touch"
  14767.   end if
  14768.   hide cd btn "Help_BackToMap"
  14769.   unlock screen
  14770.   enableNavBtn
  14771.   put "Help" into gWChilitedBtn
  14772.   if gNAVcdev is "REMOTE" then
  14773.     put "Background" into gWCcd_or_bg
  14774.     send mouseDown to bg btn "Help"
  14775.   end if
  14776.   start cd timer "alarmSelect" of cd "National" expire in 2100 ticks
  14777.   --play file (gNAVEpcotPath & gWCpath & gWCvoicePath & gWCmainMusic) nowait
  14778.   set the soundFile of bg snd "main" to 
  14779.      (gpathAudio & gWCmainMusic)
  14780.   play bg snd "main"
  14781. end mouseUp
  14782. -------------------------
  14783. on dismissPopup
  14784.   global gWChilitedReg
  14785.   global gNAVcdev
  14786. --  global gNAVEpcotPath
  14787.   global gWCpath
  14788.   global gWCvoicePath
  14789.   global gWCmainMusic, gPathAudio
  14790.   send mouseLeave to cd btn (the short name of me)
  14791.   play stop
  14792.   lock screen
  14793.   if gNAVcdev is "REMOTE" then
  14794.     hide cd bmp "Help_Remote"
  14795.   else
  14796.     hide cd bmp "Help_Touch"
  14797.   end if
  14798.   hide cd btn "Help_BackToMap"
  14799.   unlock screen
  14800.   enableNavBtn
  14801.   put "Help" into gWChilitedReg
  14802.   if gNAVcdev is "REMOTE" then
  14803.     put "Background" into gWCcd_or_bg
  14804.     send mouseDown to bg btn "Help"
  14805.   end if
  14806.   start cd timer "alarmSelect" of cd "National" expire in 2100 ticks
  14807.   --play file (gNAVEpcotPath & gWCpath & gWCvoicePath & gWCmainMusic) nowait
  14808.   set the soundFile of bg snd "main" to 
  14809.      (gPathAudio & gWCmainMusic)
  14810.   play bg snd "main"
  14811. end dismissPopup
  14812. -------------------------
  14813. on mouseDown
  14814.   global gWCacceptMouseClicks
  14815.   clearIdleAlarm
  14816.   if gWCacceptMouseClicks is not "false" then
  14817.     do "show cd bmp" && quote & (the short name of me) & "_hilite" & quote
  14818.   end if
  14819. end mouseDown
  14820. -------------------------
  14821. on mouseLeave
  14822.   do "hide cd bmp" && quote & (the short name of me) & "_hilite" & quote
  14823. end mouseLeave
  14824. downcity
  14825. leftbutton
  14826. leftcity
  14827. rightbutton
  14828.     rightcity
  14829. upcity
  14830. EINFO
  14831. AGM:Desktop Folder:POMO folder:Audio:TchUSmsc.aif
  14832. udio:TchUSmsc
  14833. mainTAIL
  14834. Zdata
  14835. ~~~~~~~
  14836. v``Q!"
  14837. <****
  14838. v``Q!"
  14839. 1111177
  14840. v``Q'$
  14841. vvxxvvv
  14842. vv``''$"
  14843. 0-08<
  14844. 117177
  14845. vvv~xv
  14846. ~~~~~
  14847. ~vxvv
  14848. pvvvvv
  14849. xxvvv
  14850. x~xvv~v~
  14851. v~vxx
  14852. xvxvv
  14853. vxvvv
  14854. ~~~~~~
  14855. 1!171717
  14856. vv``''11
  14857. 7(777(7'
  14858. vvvvv
  14859. 7717""
  14860. v```'11$
  14861. vvvvvvvv
  14862. vpvvvu
  14863. vvvvvvsv
  14864. vv`fpvvf``fv
  14865. >71'!!1771
  14866. ~~~~~~~
  14867. ~~~~~
  14868. 7!W``vvvvvvvvs
  14869. v`WW4"
  14870. !WWWv
  14871. --2--
  14872. ""'!`
  14873. vfRW4
  14874. "7!W``v
  14875. ""'/``p
  14876. xxxxx~~
  14877. "$'/`fpx
  14878. ~~~~~~
  14879. pvvvpvv
  14880. :(???
  14881. eGFH)
  14882. ??=8=
  14883. ==:?:
  14884. ?::?=:
  14885. ==8:?=8
  14886. y~if"
  14887. ??DF}F
  14888. 88:8=888=:8=8?=88
  14889. 8:??=8==8:::?=?===:8
  14890. :?:?===
  14891. ?=8:?===
  14892. ?:==?
  14893. ==???
  14894. ??????
  14895.     ppv`
  14896. p~cf&(:
  14897. =DFFD
  14898. :8:=88
  14899. 8=88==8=?::
  14900. ?=8:?8====:?===
  14901. ?:=:8?=
  14902. ???==
  14903. ?;?????
  14904. =8:88=:=8:8
  14905. 8:=8:?
  14906. 8:==8=::?
  14907. ?:=?88:=8?==
  14908. ?=8==
  14909. ::=?=:===
  14910. ?8==:=88
  14911. 8===:?8888?==:
  14912. :?888:
  14913. ???8=?8=88::?
  14914. ?=::=?=
  14915. ?==??8
  14916. ;;;;;?
  14917. ??????
  14918. 8888:=8??=
  14919. ?=?======:?:
  14920. :?:::8??
  14921. ???:???=??
  14922. ?==??
  14923. ???==
  14924.     ;;;;
  14925. 888:=8:==88=8
  14926. =8:?=
  14927. ?==:=8
  14928. ?8=?=
  14929. ?:=??
  14930. ?==?=??
  14931. ???=??
  14932. ??=??==?
  14933. ??===??
  14934. :==88
  14935. =8:==8:=8
  14936. 88?==88:8:==?:8::
  14937. =8?===?=:?
  14938. ????=??=
  14939. ?::??
  14940. ?8==?
  14941. =?=??
  14942. ?????
  14943. ~~~~~
  14944. ==88:=8
  14945. 8=8==8?::==?
  14946. :::?=8
  14947. ===?8?8:?
  14948. :?:?8
  14949. ?????????
  14950. :8::=888
  14951. 888=8
  14952. 888=8?::====8
  14953. =88:===??8?8:
  14954. ===8?=
  14955. :88=8
  14956. :?=8:8=88
  14957. 88::::
  14958. 88===888==??===8
  14959. :??=:
  14960. ??????
  14961. yyBU;;
  14962. 888:8
  14963. :?=:?=8:
  14964. ====:?
  14965. :=?=?=
  14966. ????=?
  14967. ????=
  14968. ???;????
  14969.                         
  14970. :=?==:?:?===8?
  14971. :==8?8:
  14972. y}}}}}}
  14973. ???=?
  14974. 888==
  14975. :88:8888
  14976. :?8===
  14977. :==8?8?=
  14978. ?====
  14979. 8888=8
  14980. 8=?:===
  14981. 8:?8====:=======
  14982. ~~~~~
  14983. NWWNWNWNNNWNNN{g
  14984. 88=88N|K~C~C~L====?=
  14985. CCTZZ#''''''
  14986. ////11/11/
  14987. '11/1111///
  14988. yQCYZQCCK
  14989. ?????
  14990. 88:888
  14991. ::8=8
  14992. xlj~l~CC
  14993. 88=8=::88=88=8=8
  14994. ??????
  14995. ==sF3
  14996. 88=8=:88
  14997.     <lZ3
  14998. ==_y*
  14999. {~~~{~{
  15000. !Z'/0
  15001. III-III-I-F-I
  15002. ===1{*
  15003. 8888=
  15004. 888888
  15005. ddddddddddd
  15006. ~~{{~~
  15007. 88888
  15008. :888888
  15009. Ydd~Y
  15010. 8:888
  15011. ==d'Y~Y~d
  15012. ,,((,,
  15013. 88888
  15014. =5?>?
  15015. fZ|d|Z|||
  15016. ~~~~~~
  15017. 18..8.8
  15018. 88888
  15019. g4c-8
  15020. {~~~{~{~
  15021. |>99>:=
  15022. oGKzWw
  15023. 2mR]N
  15024. Rgqq5
  15025. nUBB;
  15026. 626226(RyqR
  15027. ;??-"
  15028. vvvvv
  15029. uxmuxmux
  15030. vvsvsvvv
  15031. 8    48:
  15032. vvvvxvv~v~~{{~
  15033. {W0000E~
  15034. uEW500Mu
  15035. 85005005
  15036. xEW00W,}
  15037. 0000000g
  15038. vFW000*sa
  15039. s]W00WTv
  15040. ./>8807'
  15041. 000W:
  15042. ===d=d=
  15043. *999:
  15044. =d=~Y'
  15045. vvxx~x~
  15046. =Yd=~YYi
  15047. ~~{~~~
  15048. vvxvvv
  15049. LZLZ(
  15050. +r`Pb
  15051. ;?;?;;
  15052. :Ly|q0
  15053. JJnq.
  15054. :8::L8
  15055. vvxxv
  15056. ;;?;??
  15057. <<<<<&
  15058. <<<#<#
  15059. <<<#<#
  15060. <###8#'
  15061. ##<#<?<
  15062. `%<+@D\??
  15063. !!2!!''''''d
  15064. 2!++88!
  15065. +727.>fgU{
  15066. mtttt~s
  15067. ,-,&?
  15068. ;?;?;
  15069. Q!Wr]
  15070. :2~SKN
  15071. 47`UG
  15072. zyrzr
  15073. ???;;
  15074. !cbc^+3
  15075. <vDb3O?qD@%
  15076. Q,tWN
  15077. "rxeF
  15078. yyyyyq
  15079. yyyyyyyy
  15080. yyyyy
  15081. 77777
  15082. 6~;;1
  15083. 8HFii
  15084. <~;;1
  15085. 3?r,O
  15086. ,?s,P
  15087. !JdsO$
  15088. !7LgR
  15089. -^,Maa
  15090. 2 rvN
  15091. |MLL(,
  15092. Loeo#
  15093. 3=M|\PYwom
  15094. <-_qR
  15095. 4JdwP$
  15096. IT45)
  15097. LL[Uss
  15098. -P(Mao
  15099. x8!?Ul
  15100. &[MU7%3
  15101. +3MeW
  15102. AaL_"
  15103. ZaM^(
  15104. e<<=Mvr\(
  15105. 77?[Tc
  15106. +2-fS]C"J}|{2 2)222=+
  15107. 2LMeN
  15108. e<<3avJV
  15109. Jeee+
  15110. AI]\    
  15111.     /(oT?:cX#
  15112. Fhs{F
  15113. ]Rs~W\C1
  15114. 0A\SsqV]
  15115. *88*4
  15116. "RWR~qSV\0
  15117. "C\W~s~WO
  15118. ]Ss~S]
  15119. >,-,,
  15120. (((,,
  15121. ((,,,
  15122. 1iiiii9?5
  15123. =T==5
  15124.         =/=
  15125. !?!?!!
  15126. }}}}y
  15127. =5555
  15128. {{{{`{`
  15129. ??5???
  15130. %%%'8'88
  15131. }}}y}
  15132. Y?.--
  15133. 88888=
  15134. =:(*(
  15135. :88::
  15136. (*8::8
  15137. wJ?~;-
  15138. #MM{XM*6MggM
  15139. $AZM~
  15140. p_?]X;X
  15141.                 M/Ko"
  15142. 2("o0*
  15143.     4MMF
  15144. gwwwgwvw
  15145. =4MFlr
  15146. wwvvv
  15147. wwwww
  15148.                     
  15149. ?4y4aj
  15150. wgwwvg
  15151.                     
  15152. 4D??y
  15153.     ?4M2r
  15154. Whhh?
  15155. owwwwggwwgg
  15156. ldlowlow
  15157. wwwggwww
  15158. tldtto
  15159. wgwwvw
  15160. wwwwvwg
  15161. wwwww
  15162. vvvvvvvvvv
  15163. dlwowww
  15164. vvvvv
  15165. dtwww
  15166. zvvvvv
  15167. mooz#
  15168. U  ;uu    
  15169. .movDP
  15170. U;;%~
  15171. momzP
  15172. N ;0uu
  15173. .movDP
  15174. U;0.u
  15175. momzP
  15176. .movDP
  15177. gagu8
  15178. U;;.u
  15179. U; ;uu    
  15180. momzP
  15181. .movDP
  15182. U;;%~
  15183. U; ;uu    
  15184. ww}wwwww
  15185. mmmz/
  15186. .Eqq_4
  15187. 7_LL{
  15188. .mmvD/
  15189. 4_LLx
  15190. mmmz/
  15191. .qqs_
  15192. {sss{s
  15193. ; 0+~u
  15194. Zjqa+
  15195. +L77j{
  15196. N ;&uu
  15197. jmoz$mojN
  15198. Ejqs4
  15199. xh``+8>>
  15200. $$-%    
  15201. jooz(mo
  15202. x``X-8>
  15203. *XERx
  15204. ?_Jw-
  15205. ~~S-8
  15206. 55-%    
  15207. x~kX-+>
  15208. JJ4#a~~UXG+
  15209. -QVe@AY
  15210. =XXXXXXX
  15211. J4++a
  15212. xk`X+>>
  15213. /$<<!$++6Jf[p-
  15214. E+2;u
  15215. g]]ig]]
  15216. '&>>Un
  15217. Zqjs+
  15218. axk`-+>5
  15219. ..        ''
  15220. x-774
  15221. $<<6$<<6
  15222. O)^w/
  15223. ))^1))
  15224. wu}u}u
  15225. .h___aq
  15226. L4774
  15227. jssas
  15228. 55555
  15229. #%>>lf
  15230. iidB>
  15231. Cjm}-zmmn
  15232. J744a
  15233. -<63-<6$+???
  15234. iulK>>'
  15235. _7? `
  15236. {s{`-
  15237. T]nZ    
  15238. %8:>lwuw
  15239. wuuw}
  15240. )."66
  15241. 0O$$$(
  15242.                         
  15243. Cjmm.jmmm
  15244. ,6666
  15245. .66"6"6"6"6"6"6"6"6"6"6"6"6"r
  15246.                         
  15247. uu}uwu
  15248. 2J((:
  15249. >y            
  15250. 3F3Fu
  15251. -C^Jz
  15252. Cjmv.zmmm
  15253. r<6"D
  15254. k.."]
  15255. gkh^-8>
  15256.                             
  15257.                         
  15258.                         
  15259. :Ek$($($($(
  15260.                         
  15261.                             
  15262. 66"666
  15263.     5555
  15264. 9Jpkk
  15265. .uwuu
  15266. :|rak
  15267. u~uu~
  15268. !JEeJEEEJ
  15269. u~us3
  15270. dkiiwuu
  15271. aNaaaaa
  15272.     '    %    
  15273. /akkkkkkk
  15274. $$$5n
  15275. &/'%    
  15276. ]<6!k
  15277. ]66JE%6]
  15278. ]66.a.!6<
  15279. <6<"+6<6
  15280. ~u~uu
  15281. .''%''
  15282. u~~ZP~
  15283. www}w
  15284. aa$kk
  15285. J+-Z9,<
  15286. apKNA
  15287. Puuu~?
  15288. uuu~.k
  15289. !7akk
  15290. {xbkh
  15291. 'J74.47h
  15292. KF>SCv\\N::
  15293. E@PCFN
  15294. }H>CIC
  15295. !F>.Xaggd.
  15296. $[5&u
  15297. kkkaakkk
  15298. -c6]p>
  15299. N/%!k
  15300. kw6<]A
  15301. A]66wk
  15302. k$|||E
  15303. 4Fs4+
  15304. ::<::
  15305. :J{aa
  15306. ::::::
  15307. n.uu~
  15308. wuuw}
  15309. J]pk_
  15310. ::::::::
  15311. uuuuu
  15312. JVJ:|5|E]]6r
  15313. :::::
  15314. uuuuu
  15315. ((.kwk
  15316. ::::::
  15317. :::::
  15318. :::4:
  15319. :::<:<
  15320. $$$$$8
  15321. -pDk6
  15322. :::::
  15323. :::4:
  15324. wuwww
  15325. 9UeEak
  15326. :::::4:::
  15327. :::::
  15328. ]<6.k
  15329. ]66.k
  15330. k%6<]
  15331. -]]8p
  15332. kw"6]A
  15333. 11,/i
  15334. ::::::4:
  15335. ::::::
  15336. ::::::
  15337. :::::
  15338. ::::4:::
  15339. np||ppr
  15340. :::::::
  15341. ::4::
  15342. :4:44
  15343. :::::4
  15344. uuuuuu
  15345. A]A-!!--/$9
  15346. ::::::
  15347. :::::::<::
  15348. :<:::
  15349. :::4:::<:
  15350. wuuwu
  15351. aE--9-:UJrk
  15352. :::<:::4:::::
  15353. 4::44
  15354. :::::4::::4
  15355. ::::::
  15356. uuuuu
  15357. aal./]P]P]J!
  15358. :::::
  15359. :<::::
  15360. 4::::::::::
  15361. :::::::4
  15362. :::::4<:::
  15363. A]<+wk
  15364. A66!w
  15365. r+<]/
  15366. a66<]
  15367. Rx53RR
  15368. hh95xR
  15369. 4:::::
  15370. ==55=5
  15371. :::::::
  15372. =5555
  15373. -uJ5555555
  15374. 4::::
  15375. 4:44::::
  15376. ::::::
  15377. 5?5?555?5
  15378. 55555
  15379. ]<6.k
  15380. kk66]]!]<6
  15381. rpE8/]
  15382. Fj~~~~u
  15383. ^)))^))'?
  15384. )))^))mC
  15385. 4:4444
  15386. ~uu~~
  15387. =7@J@5
  15388. =7^Q&
  15389. 434P4'
  15390. w43P44p
  15391. L+24+
  15392. $7IJJ7
  15393. $55,w
  15394. 555555
  15395. !!!!!
  15396. k.(IJJeJeJP
  15397. aaa%aNkfk
  15398. 2Cf>Cf
  15399. Z>>Zw#
  15400. L|h>Hh
  15401. I->Fhp
  15402. >}h>>Hh
  15403. gwar{
  15404. ]<WV|<WA!
  15405. k.6<]
  15406. A<6!w
  15407. y777N
  15408. N77=y
  15409. $&<$$&<$
  15410. J!/|ra
  15411.                     
  15412. aEJJEI
  15413. w"<6A
  15414. rW!.Da
  15415. 66]/-]66
  15416. ]<%.k
  15417. ]]N.kkk
  15418. 66]-A]66wk
  15419. ]<66k
  15420. A<<"w
  15421. ]]6"kk
  15422. ffflfff
  15423. ADIf]Jk
  15424. wkaJU
  15425. 25551
  15426. -]]6!}laNaa(
  15427.         %7I
  15428. kaE:!
  15429. 21115
  15430. p$AApa
  15431. -pakpJ
  15432. A]akarJ
  15433. -J$kNa8
  15434. 1111141
  15435. 71111111115
  15436. a%k8]-
  15437. =41111115
  15438. 411115115
  15439. $8pprx
  15440. krEpE
  15441. Y6+++
  15442. ]<66k
  15443. ay77VN
  15444. kk66]]
  15445. k!6<]
  15446. *.*55
  15447. vblhB_K
  15448. "-rwwrw%" ?
  15449. tqwh'
  15450. /{IHXB2uhZHfhp
  15451. ]%%%&r
  15452. r<66D
  15453. k.%6]
  15454. A]6!wk
  15455. .rrry
  15456. qqqw =:%[
  15457. r<6"D
  15458. ]66.k
  15459. 7%WYnt
  15460. E~O8*
  15461. ak|--
  15462. +++-5
  15463.                             
  15464. +::8>+
  15465.         <I$Eu
  15466. kkwkwkwkwkDa
  15467. 82828282
  15468.     58:8>$
  15469. k|VJVJVJVEj
  15470. 1..P~kS-88
  15471. ]66.k
  15472. w!66A
  15473. 7EEEr
  15474. pI//-
  15475. a((<]
  15476. /fi{h
  15477. rrr--%
  15478. -r]]p/
  15479. k.6<]
  15480. pp8/--
  15481. 1<<<<
  15482. %&hrry
  15483. ak|N<W!
  15484. k}|$]A!
  15485. 11//i
  15486. 3W_rr
  15487. --A:lp
  15488. A-A:ll
  15489. kw<<]A
  15490. <WYrv
  15491. f.6-P
  15492. 1,m\bx
  15493. %W_hv    
  15494. <]]fa
  15495. -AA]l
  15496. 33]]rr/
  15497. AA-Vl
  15498. .__{t
  15499. !//<|
  15500. }pll:---
  15501. 51/,mb{h
  15502. %y7g]    
  15503. ]<<6k
  15504. ?="* ?9
  15505. rrEE77
  15506. 7EEEr
  15507.     ,kk.6]]
  15508. /,m!{x
  15509. ]<66k
  15510. pyIE5<
  15511. 7EEEr
  15512. |]]]!-]/
  15513. 75EIrp
  15514. ,\i{n
  15515. nb'S 
  15516. ]<6"k
  15517. 66]/rW6<Nk
  15518. aaaaa
  15519. ,ib{h%.>0
  15520. qqqY 
  15521. 66]-]]66kk
  15522. w%<6A
  15523. nqe_="
  15524. ]<6!k
  15525. r<66D
  15526. k!6<]
  15527. .3//mb{j
  15528. qn S9 
  15529. kk$EjJ
  15530. -FkF}llll
  15531. l7&&&/]
  15532. 828282
  15533. U]Eaa
  15534. ttvvvt
  15535. wl}UFF`
  15536. kkkkka
  15537. 6:::6:
  15538. 9-*%tQFF
  15539. Epppp|!
  15540. kapp<
  15541. ----!
  15542. <]]/J
  15543. :E|EEE$a
  15544. 4:4<<
  15545. kkk}E!
  15546. k."&$
  15547. akkkk
  15548. AJ+<(IIIIf]pa
  15549. ..aka
  15550. 4<40<<<
  15551. $bnuJ
  15552. ]]<!kk
  15553. -6A]<
  15554. y777N
  15555. N=77y
  15556. !6//66]]!6]]
  15557. ,AX((6--
  15558. 444:<:
  15559. yyyryyr
  15560. -pappExkk
  15561. akDrN!
  15562. k}I"lka
  15563. kaJEe<
  15564. kaE8!
  15565. 4:::<
  15566. JE$aa
  15567. -<///--
  15568. [aoa5
  15569. aNk8]]PA-!
  15570. ^)))^))3
  15571. 434P4'
  15572. !--A-|a
  15573. --$3    p
  15574. xkkka
  15575. "izxc
  15576. :EOkkaa
  15577. -77?---3q
  15578. v[Hv`3    
  15579.     n~~~
  15580. ge[Hvyn1
  15581. \w[HXw]
  15582. RwH[a(evvE
  15583. DavM[va5
  15584. :azMiX
  15585. NNNby
  15586. kkkkkkkkkkkk
  15587. 07742
  15588. 6.syyU
  15589. kkkkkkkkka
  15590. EEEEEEEEEEEE$$$$$$$$$$$$$
  15591. a$$$akk
  15592. 07245
  15593. ="wqw
  15594.                     
  15595. kkkkkkkka
  15596. |ppppr
  15597. kakkkkkkkkka
  15598. |praa|5
  15599. /]<]]IIIII]W<<<<!!!----/]///$$$
  15600. !-/p|5
  15601. Odru!
  15602. A-A:l}
  15603. U77=b
  15604. kf"6]P
  15605. ]<!.k
  15606. ka}+]]A
  15607. k\777
  15608.     |rpu
  15609. yrrry
  15610. r4-+!
  15611. A-A--P]P]r]]]]]]]$&&&!
  15612. Na/aN
  15613. aaaaaa
  15614. '!!!!'!!
  15615. -AAAAUfIfIfIIIIII]6666!
  15616. wkwwkNkNkNakakak
  15617. b&N&,
  15618. akw$NfU
  15619. !!!!!!!
  15620. ,,4661
  15621. aaakka<<W]-]<<
  15622. -<63,=7&
  15623. D.6<r
  15624. xk`^&22
  15625. =''-hrrrr
  15626. -}}kP
  15627. gk^U!,
  15628. -2-wlOP
  15629. !!!36
  15630. gk Q!
  15631. (7-33
  15632. ggmU"
  15633. 68886868
  15634. 86868
  15635. !!!!!
  15636. 3!!!!
  15637. 868686
  15638. !!!!!!!
  15639. !$&$&&$
  15640. Ekwl22lwwO
  15641. 66686
  15642. k.%<]
  15643. agSU 
  15644. FuwE;
  15645. !'!'!]66
  15646. tm U,
  15647. gkVU?
  15648. ~uwE1
  15649. ~uu~u
  15650. <2V8<2:>
  15651. I"".k
  15652. ''"&1=
  15653.     1118
  15654. 0X-8#>22
  15655. ]6%!k
  15656. 88888
  15657. gkSU?
  15658. !668888
  15659.         8888
  15660. ~kSX-8SX--~u
  15661. s~XJ?4
  15662. a$N-]
  15663. gkUQ!
  15664. ~~u~~u~u~~~u~
  15665. .;....
  15666. u~-??424+++!
  15667. &UWku
  15668. --#>8-0>
  15669. ffffffu
  15670. -XX88-X>`uufuuuu
  15671. xk`Q&
  15672. 1tSFw
  15673. ]6%.k
  15674. }F}O;
  15675. .kSS}
  15676. SSSj~
  15677.             188+
  15678. ]6!.k
  15679. kk.!J]
  15680. `^-&,
  15681. SDFn$11
  15682. 8kSSk
  15683. }SSa.
  15684. .888.
  15685. kESa8.
  15686.         18++
  15687. ]<".k
  15688. ;;;;;;;;
  15689. ;.;;;
  15690. .;.;.........
  15691. ;;;;;;;;
  15692. .;;;;
  15693. .;.;.
  15694. .;..-.;.
  15695. h($;S
  15696. kEEO.
  15697. .1++``x~
  15698. h<O;h
  15699. 8^S^S
  15700. uuff-A'A
  15701. ]uQh(
  15702. u~~u~
  15703. `-"..
  15704. ISlwr.
  15705. UY`;]cw
  15706. ~~~`444!
  15707. A<6!w
  15708. .;..;.........8.8.8
  15709. )))---
  15710. (77777
  15711. 17777="
  15712.     88181
  15713. ^>uu~
  15714. 77 57
  15715. .8.CA
  15716. 55$5$
  15717. $5555
  15718.     ''''=
  15719. t{v{{tvt
  15720. 1<115
  15721. $$5555
  15722. !JNaNaNaNaNwww
  15723. n{{yp
  15724. .}}wS2U}}O(
  15725. +'8gmOP?
  15726. $$$555
  15727.     '''.
  15728. ====555
  15729. 88rJJJ
  15730. 555555
  15731. rlryryr
  15732. 55555
  15733. tlyvt
  15734. 5555555
  15735. 5555555
  15736. <=011=
  15737. !+-!!!!!!!38888888
  15738. 63363
  15739. 555555
  15740.             >    
  15741. 3343333
  15742. 08=<=
  15743. g9RRR
  15744.                         
  15745. RDRRR
  15746. ~~~ux
  15747. 363333
  15748. 55555555
  15749. sssssusss
  15750. Ot))@19")wwwwwgF^^^*
  15751. 666336
  15752. X--m-[-
  15753.     18>8>8>818>1
  15754. 6:27(
  15755. 6>333
  15756. }-Su}}.
  15757. S/2Ck
  15758.     '8'&
  15759. 55555
  15760. 88*llltv
  15761. 66666((2
  15762. ?5555
  15763. 3>164
  15764. _6)0Pi
  15765. ,/#s`
  15766. 14343
  15767. $5$55
  15768.                     
  15769. 38386
  15770. 5555555
  15771. v{vt{
  15772. 30888;8838
  15773. 43343934
  15774.                     
  15775. Filnlw
  15776. =3111
  15777. 63383;
  15778. 33383
  15779. $.55v
  15780. ?5555
  15781. ?5555
  15782. ;>633
  15783. 36646
  15784. iPg^9
  15785. 555555
  15786. 55555
  15787. 3=332
  15788. 4?33663
  15789. SUUUU-)-
  15790. 555555
  15791.                             
  15792. 46366
  15793. 3333334
  15794. \k$)$&0
  15795. 5555555
  15796.                     
  15797.                     
  15798. 55555
  15799. =1111
  15800. 888;4
  15801. 55555
  15802. ;8888
  15803. 9999^^gf88
  15804. OxFF6
  15805. ^g 99
  15806. &&$$55
  15807. *<5;'
  15808. =111='88
  15809. PPPiiiP
  15810. ,====
  15811. ,==,=
  15812. 55555
  15813. Nsrsw#
  15814. 4sL@V9w;
  15815. :5555555
  15816. GMGtG{
  15817. 555u.
  15818. ^^^^R
  15819.                     
  15820. =b6S@^^g
  15821. s^9'-s
  15822. ..""S
  15823. ^9!KE,486>2
  15824. kmtP$$*
  15825. 3;;03
  15826. 1"&PmyMf>9
  15827. 9)-K"288668
  15828. kktP$8*
  15829. 1$Pkta
  15830. `kax%.$*
  15831. XYXXY_YX^
  15832. ||AAAAAAANN^NXXXXXXXXXXXXXXXXX
  15833. XGGXGGXGXGXGXGXXXXXXXXXXXXXNXNXN
  15834. =$`Pxa
  15835. 9{~b(
  15836. WhNu;
  15837. XNA|$2=
  15838. A$$2=
  15839. E@wh-
  15840. ;~jV?
  15841. =;aG1
  15842.     =4+t
  15843. Y^^Y^
  15844. ^>[<4
  15845. ^^^^^^
  15846. YX^Y_
  15847. 88868
  15848. XXYXXY
  15849. G<<<<GX
  15850. u@o@|u
  15851. XXYX^
  15852. XXXXX
  15853. YXYXYXYX=
  15854. YXYXYXYY
  15855. YYYYYYYYY
  15856. gPgA^X
  15857. XXXXX
  15858. SSSSSSSSS
  15859. ^^^^^
  15860. IHIHIHIH
  15861. IHIHIHII
  15862. IIIIIIIIIY
  15863. g!Err
  15864. AEQEC
  15865. XXXXX
  15866. $Z%kkXX
  15867. :#(E>
  15868. XXXXX
  15869. ImII-==
  15870. -IFdY
  15871. XXXXX
  15872. s(cun
  15873. (c>c>
  15874. s(c>c>
  15875. 81118
  15876. dd=d===
  15877. 11111    
  15878. 111111
  15879. =Zmtg
  15880.     ><<2
  15881. `ggk/==
  15882. Id@YY==
  15883. ")g{xxx
  15884. xg7Z?
  15885. P"odgg(
  15886. dg{f!x{y!x{{dx
  15887. 5,&VBD
  15888. f$cBD
  15889. 2:C.2
  15890. ,><<<
  15891. xxx{7X
  15892. dd=dd==
  15893. (X!!!y`##^
  15894. -+-+-
  15895. smssr
  15896. yE'#(Ey
  15897. )^@1o1o>^og`^YgYgYg
  15898. IHmI7II7
  15899. ImI7II==
  15900. GQyQG
  15901. g^^^^
  15902. 46SS1
  15903. :d:d:d:d
  15904. :deeedeeedeeed
  15905. A|$$=
  15906. NA$|2=
  15907. 50+VpGD
  15908. ========
  15909. ========
  15910. ===:^^^^==
  15911. ?=de^
  15912. ^^^Y^X
  15913. oXXXX
  15914. XXXXXX
  15915. YXXYXXYX
  15916. XXXXX
  15917. XXXXX
  15918. fgtk/7
  15919. 6<2`k
  15920. L<XXX
  15921. 7*fGGE
  15922. 2)$rBD
  15923. kgtZ;
  15924. 9;682-
  15925. ========
  15926. 27)$fGD
  15927. 3$fGCK
  15928. ^iij7
  15929. 9;4682
  15930. >27)$fG[
  15931. gjjj1
  15932. kmtZ1
  15933. \CcyHNXX
  15934. ====    
  15935. xPuM5
  15936. 822)$fp[K
  15937. (22-mOEE
  15938. AlwQ&)5
  15939. nPsu#
  15940. >82023
  15941. =$Skgm
  15942. ;Aiwc
  15943. 0:7:0:
  15944. 0:0:0::=
  15945. cwiA;
  15946. ;Ticf&
  15947. (82-k~tZ1
  15948. $=$&kgaj
  15949. 5Tiwm
  15950. <-`mtZ0
  15951. ="Xkxx
  15952. ;1Tfp~
  15953. ~pfT$;
  15954. ;Thkc
  15955. (82-kmtZ1
  15956. ppppp
  15957. ;1Tfp~
  15958. ~pfc$
  15959. <2XmtE0
  15960. 88<-k~LE1
  15961. Mxxg*
  15962. -8<-`~tZ:
  15963. 3=133?1
  15964. ;xgx\
  15965. (82-kmLZ1
  15966. Bxgg:
  15967. -8<-`mtZ0
  15968. _gxx8
  15969. 62-kmtZ1
  15970. -82<`mtE0
  15971. vdf\*88
  15972. 8<`m~L07
  15973. ddd_88'
  15974. gqb`-
  15975. d&*'8
  15976. 62-k~tE1
  15977. #gtIQ"1    
  15978. 82-`mtZ0
  15979. 82-k~tZ
  15980. dgd_&\_d
  15981. `mtZ07
  15982. ,822-
  15983.     yfdT
  15984. ;;;8;
  15985. :CC_y
  15986. ;;?;;
  15987. 8C%Cd
  15988. >^qIO
  15989. 0020-2207)
  15990. ;;;8;;
  15991. ttDt81.
  15992. 0vvvv
  15993. >[aad
  15994. 7UU_b
  15995. tqia.+    
  15996. :    + [hpz
  15997. ;;;;;
  15998. ;)f);;
  15999. ;;;;;;    .
  16000. vtvvv
  16001. +>=266>>[.dtu
  16002. ;;;;;
  16003. ;;;;;;
  16004. ;;;8;;
  16005. vvvvv
  16006. ud.>26
  16007. ;;;5;;;;;8
  16008. ;;;;;
  16009. 8;;8;8
  16010. ;;888
  16011. ;;;888&8
  16012. ;;';u
  16013. ;;8;;;;;88
  16014. ;;;;8
  16015. 8;;;;8;8
  16016. ttdeiea>
  16017. uptttt
  16018. $axxxu
  16019. 5#*;;
  16020. 88;;;88
  16021. 8;;;;8;
  16022. tqtdt
  16023. {qddtqe
  16024. .22?26
  16025. #8*8;;8;8;
  16026. 8;;;8;;;;8;;8;
  16027. tttttttt
  16028. +22.+>6
  16029. 88;;;8;8
  16030. ;;;;88
  16031. 8;;;;;;8;;
  16032. 8;;;;;;;;88;;;;
  16033. 8;;88%
  16034. zlinwrf
  16035. 888;8
  16036. 8;;;8
  16037. ;8;;;;;;88;;
  16038. ;;;;;;;;88;;
  16039. >->>269>>2
  16040. pp{{{
  16041.         rwof8
  16042. 88;8;
  16043. 8;\^\W^W^d8
  16044. ::::::
  16045. 8data
  16046. 5TAIL
  16047. )data
  16048. ===55555
  16049. &&$$55
  16050. ,====
  16051. ,==,=
  16052. 55555
  16053. :5555555
  16054. 555u.
  16055. XYXY^^
  16056. Y^^^^^Y_Y^^
  16057. =>2Dm
  16058. Y^^^^^^
  16059. XY_Y_
  16060. I-d===
  16061. Y---d
  16062. Q"    te
  16063. ;]unjvofe
  16064. XY^XYY^
  16065. hdedede\\d]\d]\d]\]\d]\]\d]\]\]\<]\<];<]
  16066. ]<;<<<
  16067. <944:
  16068. $=$&kgaj
  16069. ."Xkkx
  16070. xgggxgg
  16071. (((((;
  16072.     11118
  16073. 8";"8"8"
  16074. +1+1+
  16075. ""88"
  16076. 811181
  16077. 8181111.
  16078. ETAIL
  16079. +data
  16080. 55555
  16081.                     
  16082. ?5555
  16083. ?5555
  16084. 555555
  16085.                     
  16086. 55555
  16087. &&$$55
  16088. ,====
  16089. ,==,=
  16090. 55555
  16091. :5555555
  16092. 555u.
  16093. _YXY^^
  16094. XYXXY_YX^
  16095. a$K^nz
  16096. Y^^^^^Y_Y^^
  16097. ===Fm
  16098. Y^^^^^^
  16099. XY_Y_
  16100. <6    &mta
  16101. ^^^YXXYX
  16102. Y^^YXXYX
  16103.     ggxg
  16104.     xggx
  16105. %xggxgggxgxM
  16106. 6G@AGGGGG
  16107.     gxgg
  16108. $=$&kgaj
  16109.     xgxg
  16110. .$Xkk~
  16111. gxgxgxgg
  16112. (((((;
  16113. '*%%CC\C}
  16114. gbgbt{JCL}t{J
  16115. 8;;8;
  16116. ;;;8;;
  16117. ;;;;;;;
  16118. ;;;;;;;;;;
  16119. 8;8;;;;;;;;;;;
  16120. XTAIL
  16121. -data
  16122. ,====
  16123. ,==,=
  16124. 55555
  16125. :5555555
  16126. 555u.
  16127. _YXY^^
  16128. YXXY_YX^
  16129. a$o^nz
  16130. Y^^^^^Y_Y^^
  16131. Y^^^^^^
  16132. XY_Y_
  16133. -d=dX
  16134. d---d---
  16135. --d---
  16136. YXYYX
  16137. ^Y^^^XY_
  16138. styphho
  16139. \edde\de\Rd]dd]\]\d]\]\d]\]\];]\<]
  16140. ];<]<<<<<
  16141. $=$&kgaj
  16142. ="Xkxx
  16143. gxgxggxg
  16144. (((((;
  16145. G@@@G
  16146. xgxggxgx;
  16147. __xgxxxx
  16148. 6G@@@@G@
  16149. ETAIL
  16150. /data
  16151. ===55555
  16152. ,====
  16153. ,==,=
  16154. 55555
  16155. :5555555
  16156. 555u.
  16157. zzzzzzzz|||z||||||zs|s||W|
  16158. bzzszzxxzzszz
  16159. _YXY^^
  16160. XYXXY_YX^
  16161. Y^^^^^Y_Y^^
  16162. Y^^^^^^
  16163. XY_Y_
  16164. =YXYX=
  16165. YYXYYYXY
  16166. ?<<6h
  16167. YXYXYXY
  16168. XYXXY
  16169. Y^^^Y_
  16170. xgxggggxg_
  16171. $=$&kgaj
  16172. ="Xkxx
  16173. q@@@G
  16174. gxgxgxgg
  16175. (((((;
  16176. G@@@G
  16177.     11118
  16178. 8";"8"8"
  16179. +1+1+
  16180. ""88"
  16181. 811181
  16182. 8181111.
  16183. ETAIL
  16184. 1data
  16185. ===55555
  16186. &&$$55
  16187. ,====
  16188. ,==,=
  16189. 55555
  16190. :5555555
  16191. 555u.
  16192. XYXY^^
  16193. mwDod+
  16194. a$o^nz
  16195. Y^^^^^Y_Y^^
  16196. Y^^^^^^
  16197. XY_Y_
  16198. ---d---d
  16199. YXYXY
  16200. Y^^^^^YXYX
  16201. Y^^^Y_
  16202. _YYXY
  16203. poohdhdede\\d]\d]\d]\]\d]\]\d]\]\]\<]\<];<]
  16204. ];<<<<<
  16205. $=$&kga`
  16206. ="Xkxx
  16207. xgggxgg
  16208. (((((;
  16209.     11118
  16210. 8";"8"8"
  16211. +1+1+
  16212. ""88"
  16213. 811181
  16214. 8181111.
  16215. ETAIL
  16216. 3data
  16217. 5WWWb
  16218.     sssb5
  16219. &&$$55
  16220. ,====
  16221. ,==,=
  16222. 55555
  16223. :5555555
  16224. 555u.
  16225. XYXY^^
  16226. mwDoe
  16227. a$o_nz
  16228. Y^^^^^Y_Y^^
  16229. Y^^^^^^
  16230. XY_Y_
  16231. YYYYYYY
  16232. YYYYYYYY
  16233. YYXYXY
  16234. YIIIIIII
  16235. IIIIIIII
  16236. IHIHIHI
  16237. IIII-==
  16238. d====
  16239. =d=d====
  16240. IIIdddI--dIII
  16241. ddYY==
  16242. d=d==
  16243. tI-IIY
  16244. YIIIIII-I==IIIIII-Id==
  16245. YYdddd
  16246. YYYddd
  16247. YX^Xd
  16248. YXYYY
  16249. Wmtau
  16250. Y^^^^XYXXY
  16251. Y^^^X
  16252. XY^^Y_
  16253. _YYXY
  16254. #ggggxg_
  16255. 6G@AGG
  16256. $=$&kgaj
  16257. ="Xkxx
  16258.     gxgg
  16259. xgxggxgg
  16260. (((((;
  16261. #xxggxgx;
  16262. __xgxxxx
  16263. 6G@@@@G@@
  16264. ETAIL
  16265. RDU 96TAIL
  16266. f===8
  16267. WZWZW
  16268. p===f
  16269. ,7,,7,,
  16270. zb"$?$$?$$z
  16271. ~k]]?~
  16272. ,,,,,,,{
  16273. {,v,v{+{v{vv{
  16274. ===;    
  16275. ==4;4==
  16276. bbs B
  16277. bbs B
  16278. bbs B
  16279. A!+TXT
  16280. WednesdayTAIL
  16281. ThursdayTAIL
  16282. FridayTAIL
  16283. 64 / 35TAIL
  16284. / 35T+TXT
  16285. 65 / 36TAIL
  16286. / 36T+TXT
  16287. 73 / 46TAIL
  16288. / 46T+BiO
  16289. 6VV0V66
  16290. iTV=g
  16291. VT3Ti
  16292. =!=!3!3!!!!!=!3==
  16293. TA+TXT
  16294. As of Tuesday, December 27, 1995 TAIL
  16295. 995 TAIL
  16296. !data
  16297. =data
  16298. Edata
  16299. ll~l~~LC
  16300. 2/s{*
  16301. ==FH*
  16302. III-III-I-I-I
  16303. ddkdddddddd
  16304. Ydd~Y
  16305. ======d
  16306. d~Y~d
  16307. =5?>?
  16308. Z?>fY
  16309. fZfd|Z|||
  16310. ===d=d=
  16311. =d=~Y'
  16312. =Yd=~YYi
  16313. `%<+@D\??
  16314. |    ;;yr
  16315. !cbc^+3
  16316. <vDb3O?qD@%
  16317. 77777
  16318. 8HFii
  16319. DaaP-]
  16320. qTAIL
  16321. qTA+BiO
  16322. 5data
  16323. &&$$55
  16324. 55555
  16325. :5555555
  16326. 555u.
  16327. XYXY^^
  16328. Y^^^^^Y_Y^^
  16329. Y^^^^^^
  16330. XY_Y_
  16331. YYYYYYYY
  16332. YYYYYYY
  16333. IIIIIIIY
  16334. IIIIIII
  16335. YHIHI
  16336. XIHIHHI
  16337. IIIId=
  16338. IIIeY
  16339. IIII==
  16340. -IIIY=
  16341. IIIIIII
  16342. IIIIIII
  16343. HII=Y
  16344. Ydddddd=
  16345. =Yddddddd
  16346. YYXY^^^^
  16347. Y^^Y_
  16348. Q"%ed
  16349. _YYXY
  16350. ddede\\d]\d]\d]\]\d]\]\d]\]\]\<]\<];<]
  16351. ];<<<<<<<
  16352. $=$&kgaj
  16353. ="-kxxa
  16354. xgggxgg
  16355. (((((;
  16356.     11118
  16357. 8";"8"8"
  16358. +1+1+
  16359. ""88"
  16360. 811181
  16361. 8181111.
  16362. ETAIL
  16363. &data
  16364. :data
  16365. @+BiO
  16366. ;data
  16367. @+BiO
  16368. Hdata
  16369. d0dxk
  16370. !T!T[!Tdx
  16371. RTk^bk9_^
  16372. Tdddd60
  16373. 59dkP_
  16374. !T0Tw
  16375. 60606kdd9dd
  16376. w!60609
  16377. ZH,U0
  16378. ^0[x!
  16379. |6dk^t
  16380.  UcZbz9
  16381. C[~ Z1Gb
  16382. d9d6k69[C
  16383. R9999
  16384. z9k999C6
  16385. ^_Pu9R6999
  16386. Idata
  16387. Jdata
  16388. c$]c!
  16389. `Iw65
  16390. `wc55
  16391. Ewq5!
  16392. TA+BiO
  16393. Kdata
  16394. Ldata
  16395. !!wE5
  16396. !!wI`^
  16397. 55cIw
  16398. !55Nk
  16399. Pdata
  16400. ,6\\ff
  16401. 111717
  16402. 1111177
  16403. }hf\fffffff\\P\\f
  16404. 117177
  16405. QHHQH
  16406. (TAIL
  16407. (TAIL
  16408. NationalSCRP
  16409. on openCard
  16410.   global gWCcurrReg
  16411.   global gWCcurrCities
  16412.   global gWCnatcities
  16413.   --  global gWCnatcitiesInit
  16414.   global gWCinitialReg
  16415.   global gWCreg_or_btn
  16416.   global gWChilitedReg
  16417.   --  global gWCalarmIsSet
  16418.   global gWCwhichday
  16419.   global gWCdate
  16420.   global gNAVcdev
  16421.   global gWCacceptMouseClicks
  16422.   global gWCacceptClickDelay
  16423.   global gWCdemoShown
  16424.   global gWCfirstTimeIn
  16425.   --  global gNAVEpcotPath
  16426.   global gWCpath
  16427.   global gWCvoicePath
  16428.   global gWCmainMusic,gPathAudio
  16429.   global gWCplayedregVoice
  16430.   put "false" into gwcplayedRegVoice 
  16431.   put "false" into gWCacceptMouseClicks
  16432.   if gWCfirstTimeIn is "false" then
  16433.     --ring cd alarm "alarmSelect" of cd "National" at 2100
  16434.     start cd timer "alarmSelect" of cd "National" expire in 2100 ticks
  16435.     --play file (gNAVEpcotPath & gWCpath & gWCvoicePath & gWCmainMusic) nowait
  16436.     set the soundFile of cd snd "main" to 
  16437.        (gPathAudio & gWCmainMusic)
  16438.     set the bufferSize of cd snd "main" to 180
  16439.     set the playVolume of cd snd "main" to 100
  16440.     play cd snd "main"
  16441.   else
  16442.     put "false" into gWCfirstTimeIn
  16443.   end if
  16444.   put "Day2" into gWCinitialReg
  16445.   if gNAVcdev is "REMOTE" then
  16446.     put "button" into gWCreg_or_btn
  16447.     put gWCinitialReg into gWChilitedReg
  16448.     do "show cd bmp" && quote & gWChilitedReg & "_hilite" & quote 
  16449.   end if
  16450.   put "today" into gWCwhichday
  16451.   put the number of this card into gWCcurrReg
  16452.   put "false" into gWCalarmIsSet
  16453.   put gWCdate into cd fld "DayOfWeek"
  16454.   show cd fld "DayofWeek"
  16455.   put empty into gWCnatcities
  16456.   put "Albuquerque  ABQ 1" into line 1 of gWCnatcities
  16457.   put "Atlanta  ATL 8" into line 2 of gWCnatcities
  16458.   put "Bismarck  BIS 11" into line 3 of gWCnatcities
  16459.   put "Boston  BOS 15" into line 4 of gWCnatcities
  16460.   put "Chicago  ORD 80" into line 5 of gWCnatcities
  16461.   put "Denver  DEN 32" into line 6 of gWCnatcities
  16462.   put "LosAngeles  LAX 61" into line 7 of gWCnatcities
  16463.   put "NewOrleans  NEW 77" into line 8 of gWCnatcities
  16464.   put "Orlando  ORL 82" into line 9 of gWCnatcities
  16465.   put "Portland  PDX 85" into line 10 of gWCnatcities
  16466.   put "SanFrancisco  SFO 105" into line 11 of gWCnatcities
  16467.   put "WashingtonDC  DCA 31" into line 12 of gWCnatcities
  16468.   put gWCnatcities into gWCcurrCities
  16469.   putinNewData (the number of this card), gWCnatcities, 0
  16470.   if gWCdemoShown is "false" then
  16471.     demohilite
  16472.     put "true" into gWCdemoShown
  16473.   end if
  16474.   --ring cd alarm "alarm_loseClicks" at gWCacceptClickDelay
  16475.   start cd timer "alarm_loseClicks" expire in gWCacceptClickDelay ticks
  16476.   --set the textcolor of cd fld "albuquerque" to 18
  16477. end openCard
  16478. n+BiO
  16479. tINFO
  16480. Tuesdaydata
  16481. UeUU80
  16482. <31,<8
  16483. ,1;15
  16484. <>UXik
  16485. <UUXi
  16486. 331113,131331
  16487. 131?1
  16488. ?.###
  16489. Y=}V=
  16490. ^^Y^^
  16491. X^XY_
  16492. XXYXXX
  16493. X^XY_
  16494. =ttt\
  16495. Vtaa=
  16496. ^^^^XYXYXY
  16497. Y^^XY^^^Y
  16498. XY^^YXY_Y
  16499. Y^XY_Y_
  16500. XXY^^
  16501. _Y_Y^
  16502. Y^^^^^^Y_
  16503. Y^^^^YXXYX
  16504. Y^^^XY^
  16505. Y^^^^
  16506. Y^^^^
  16507. Y^^^^^^
  16508. Y^^^^^^
  16509. YYYYYYYYX
  16510. ^^^^^
  16511. YYYYYYYXYX
  16512. YIIIIIIIIH
  16513. ^^HIH
  16514. IIIIIIIHI
  16515. IHHHI
  16516. ----d
  16517. H=/HH
  16518. F-e---
  16519. e|XXXY
  16520. 666Xn
  16521. 63  fwfA;
  16522. de>=.
  16523. -I--?
  16524. a>222
  16525. FI---d
  16526. 5------d
  16527. HI----
  16528. I-m5-
  16529. Y^==eY
  16530. ===8^
  16531. _Lde}
  16532. eegege
  16533. ^^^Y_
  16534. ^YXXY
  16535. ptpp{{{
  16536. YY_Y^
  16537. Y^^Y_Y_
  16538. YY_Y^
  16539. Y^^^^
  16540. vvye666
  16541. BAobtk
  16542. lJ)$0
  16543.  $))    
  16544. XYX_Y
  16545. ]766k
  16546. Qdd~e
  16547. =LB)j
  16548. YXYXXYXY
  16549. Qzdk/
  16550. A4AAuu
  16551. Z/;14=;MuR
  16552. 34+8W~~i2
  16553. &^``~
  16554. ~pdd!$6#
  16555. RZX/4
  16556. =/ZK|O
  16557. 7Jnvl
  16558. 5<[vqB2
  16559. 5+-X`
  16560. x~~uu~xx
  16561. qpdd! 0#
  16562. '##"fddp
  16563. @Oa//82                    8//Z
  16564. :7JOnl    
  16565.     *056
  16566. &_WWT52
  16567. g/144            
  16568.             ==/;
  16569. 55dQnn
  16570.     ++3:
  16571. 5.PWn\&32
  16572. !144            
  16573.                 =1/Z
  16574. d`5$.
  16575. ......
  16576. .:..$!.
  16577. AAAAu
  16578. up[[[+:
  16579. :"PPmX443
  16580. >->8>
  16581. 1=4=    
  16582.             41/1
  16583. 1>>--8>>>>>
  16584. ->>>8>>
  16585. !!#644
  16586. uuukkkkukkuuu
  16587. 53:3    :
  16588. RJTUOrl
  16589. -0.))
  16590. ;n            
  16591. 9::::
  16592.  $($$$$$2>LVvdXH2
  16593. $$$d9
  16594. alltn
  16595. e_hed*
  16596. ?9?89
  16597. ".**8*hrv0
  16598. 8084<0
  16599. =PPTP<<<<12<<PfcfPENJPEP\h\h\PPPPPJJP`hhh
  16600. hhh~hhhf0$#&#&02.28>>8JPPMP`\M\h\h`hhhhhhhhh\\\hhh\`fhTAAAA)) 
  16601. ## &&00.0122822228<<<<<<<80.........)...288288882
  16602. 8""4-*8,
  16603. ul*bq
  16604. {{{p    3:
  16605. 04604848&8^siilfdvl
  16606. hl*8X
  16607. {tgh~^n
  16608. l62266
  16609. rhXb-ThdV,`hhdX
  16610. 999999
  16611. 999999
  16612. <:9<<59:5
  16613. 995<<<
  16614. 3044?
  16615. 8686:
  16616. <:999
  16617. QTAIL
  16618. aINFO
  16619. `INFO
  16620. #NAME
  16621. endMovieTAIL
  16622. aINFO
  16623. CNAME
  16624. idleTAIL
  16625. ADGRPO
  16626. zINFO
  16627. <CARD
  16628. Days_3data
  16629. yTAIL
  16630. sdata
  16631. ADGRPO
  16632. <INFO
  16633. "CARD
  16634. Citiesdata
  16635. AGRPO
  16636. qINFO
  16637. NCARD
  16638. Orlandodata
  16639. eansdata
  16640. pINFO
  16641. NewOrleansdata
  16642. uedata
  16643. oINFO
  16644. Albuquerquedata
  16645. nINFO
  16646. LosAngelesdata
  16647. nDCdata
  16648. ,GRPO
  16649. mINFO
  16650. QCARD
  16651. WashingtonDCdata
  16652. AGRPO
  16653. lINFO
  16654. Atlantadata
  16655. ADGRPO
  16656. kINFO
  16657. ECARD
  16658. Denverdata
  16659. anciscodata
  16660. ,GRPO
  16661. jINFO
  16662. SanFranciscodata
  16663. ADGRPO
  16664. iINFO
  16665. ^CARD
  16666. Bostondata
  16667. godata
  16668. AGRPO
  16669. hINFO
  16670. Chicagodata
  16671. ckdata
  16672. gINFO
  16673. CCARD
  16674. Bismarckdata
  16675. ddata
  16676. fINFO
  16677. Portlanddata
  16678. ldata
  16679. 7CARD
  16680. Nationaldata
  16681.   +BiO
  16682. WestSCRP
  16683. on mouseUp 
  16684.   -- visual effect scroll right
  16685.   --regionBitmapPush(the short name of me)
  16686.   answer "This region has been disabled in the demo version."
  16687. end mouseUp
  16688. --------------------------
  16689. on mouseDown
  16690.   regionBitmapDown(the short name of me)
  16691. end mouseDown
  16692. --------------------------
  16693. on mouseLeave
  16694.   regionBitmapLeave(the short name of me)
  16695. end mouseLeave
  16696. downregion
  16697. Button Day1 Day2
  16698. leftregion
  16699. rightregion
  16700. South
  16701. upregion    NorthWestdata
  16702. .26--
  16703. ll~`l`dd`d``M`MMMMMJMMB>;;;;;;;0000)0&&0&&&&&&&&# ####
  16704. >&/-/
  16705.     26-/
  16706.     12/--
  16707. 2&/--
  16708. >&/--
  16709. >&6--/
  16710.     1&/--
  16711. >&6/--
  16712. 1&/]A
  16713. {&{    {&{    
  16714. 1&/]--
  16715. >&&//--
  16716.     ;;;>qqqs***3
  16717. &{I9{
  16718. zzmm+
  16719. &&&&&&
  16720. &&&&&&
  16721. &&&&&&
  16722. {&&2I--IIp
  16723. ]I959I]]2&g{g{
  16724. ,iYaU
  16725.     {{g7IIA
  16726.     {{g>2;]]A99UI];6>g{{    
  16727. "2;]IA
  16728. UI];62g{{{    
  16729.     {{g>2;]IA;U]]];&
  16730.     {{g    26]]U-9UI];6>1
  16731. 22;]IA
  16732. 3:41888
  16733. 48888388
  16734. :8888
  16735. 88888
  16736. 88888
  16737. <:1:1
  16738. 8<<88<>
  16739. <>>6>>
  16740. 8<<888888
  16741. 88:<>6
  16742. >6>6>66
  16743. 8<:4<16>6>
  16744. 88888
  16745. 888888
  16746. 8<88<1:>:>>>:>
  16747. 8:8>8<
  16748. p*?%<
  16749. q*++2 92
  16750. >>>>>
  16751. YMYMMM
  16752. >>>>>>>>>>>>
  16753. {22{{22{
  16754. Y[[[[^7-
  16755. MMMMMM
  16756. p~322
  16757. ivvvivvv
  16758. ]&&2{
  16759. v777^
  16760. -2$$fh
  16761. (((70
  16762. ~pp~pppp
  16763. ~~~~~~~
  16764. ~~~pp~~p
  16765. pqpqpq
  16766. ~pp~~
  16767. pp~~~
  16768. ~~~~~
  16769. -111;
  16770. ~~~~~
  16771. ~pp~~~pp~p
  16772.     ~~~~~~
  16773. ~~p~~p
  16774. ~~~~~~
  16775. ~pp~~~pp
  16776. ~~~~~~
  16777. 75"-s`
  16778. ss~&4
  16779. <>666>
  16780. >>>-``m~
  16781. -9+++!
  16782. 2++!!!
  16783. ffhffhh`hhhhhh``PJJ<<MMPJ>8;;BM`~
  16784. }ofTffff\P```MP````PP8>J`JJ>>;;>M`lhhl~
  16785. fff\TcfP\MPJJJJPMMJJ>8;JJJ;;88;>MP``~~
  16786. }ffTff\f\PJJ>82888>;;8;888800028>JM`lh~
  16787.  +BiO
  16788. SouthSCRP
  16789. on  mouseUp
  16790.   -- visual effect scroll right 
  16791.   -- regionBitmapPush(the short name of me)
  16792.   answer "This region has been disabled in the demo version."  
  16793. end mouseUp
  16794. --------------------------
  16795. on mouseDown
  16796.   regionBitmapDown(the short name of me)
  16797. end mouseDown
  16798. --------------------------
  16799. on mouseLeave
  16800.   regionBitmapLeave(the short name of me)
  16801. end mouseLeave
  16802. downregion
  16803. Button Day3 Trivia
  16804. leftregion
  16805. rightregion    Southeast
  16806. upregion
  16807. Centraldata
  16808. ...6$$$$$
  16809. ...6$$$$$
  16810. ...6$$$$$
  16811. ...&$$$$
  16812. ....&$$$$
  16813. ."kaEI
  16814. ]NN]]]<I"""".kwkwkkkkkk
  16815. ]]/N<]]]IIUI97]U]UINN]]]<I""k
  16816. kkkkkwk
  16817. 6"6"I/N<]]]I9
  16818. $$$$$$$$$
  16819. kkkap
  16820. $$$$$$$$$$$$6&6&.......
  16821.     $$6$
  16822. 6666666666
  16823. 666666
  16824. 6666666666
  16825. 6666666
  16826. 6666666666
  16827. Ekk.kk
  16828. kI]]]]
  16829. kIII<IAI.""k
  16830. kkk%I]
  16831. kkkkk
  16832. I.I<]]E."k
  16833. <]]]]]-I
  16834. kIIU;]]]]]]]I/Ik
  16835. kk!kk.(]
  16836. k6I<I-I;I""kkkkkkkk]9IA
  16837. pkkkwk
  16838. .""""""""I<]<//
  16839.     "66"
  16840. ;UI9r
  16841. ](6"""""("
  16842. kkkkk
  16843. <$6...
  16844. &%wkwkkkk
  16845. $$$$&...
  16846. wNUI]]]("".k
  16847. .%(I<]]IIU5I9I]]]<(""
  16848. wkkkkk
  16849. kkkkw
  16850. "(I<]]]IIU;UII]]](""(
  16851. !!!!!
  16852. kkkkkw"""I<]]IIU;
  16853. kkkkw
  16854. .H_dR!66.
  16855. ~sss[`
  16856. sss``
  16857. 8111.
  16858. <$$$$6&6&.......
  16859. "PXaM%
  16860. %$RIYU
  16861. <$$$$
  16862. $$<...
  16863. 6666666666
  16864. 6666$
  16865. ;$..$$$<.
  16866. 222222222
  16867. 222272727
  16868. =CMM[i
  16869. avii[Tf0<+++.7
  16870. <<UUUUUUU
  16871. 11111
  16872. qpppp
  16873. <<..$
  16874. 22222
  16875. vkK$6!
  16876. ~~p\-- 
  16877. 2:222
  16878. v|q/66.
  16879. ?33>33
  16880. 33393333
  16881. <31>3>
  16882. 31;7;
  16883. hT$;-
  16884. AAUUUXikp
  16885. ptiXUAG@A@GGGAG
  16886. G@UOUUXkt
  16887. kiUUAAG@@@A@G@
  16888. @GAUUOXik
  16889. piXUUGA@@@AGAG
  16890. AG@AUUXXkp
  16891. tXUXOAGA@@@@@A
  16892. @@GGOOXXkkp
  16893. kXXOXA@G@A@@A@
  16894. dpppp
  16895. on mouseUp
  16896. CentralSCRP
  16897. on mouseUp
  16898.   -- visual effect scroll right 
  16899.   -- regionBitmapPush(the short name of me)
  16900.   answer "This region has been disabled in the demo version."  
  16901. end mouseUp
  16902. --------------------------
  16903. on mouseDown
  16904.   regionBitmapDown(the short name of me)
  16905. end mouseDown
  16906. --------------------------
  16907. on mouseLeave
  16908.   regionBitmapLeave(the short name of me)
  16909. end mouseLeave
  16910. downregion
  16911. South
  16912. leftregion
  16913. rightregion
  16914. MidAtlantic
  16915. upregion
  16916. Northdata
  16917. WxWW/
  16918. ax]]xx
  16919. EUOCCx]x]]/-
  16920. xzCCWx]]]/-
  16921. xzCCWC]]]/-
  16922. xzCCCx]]]-/
  16923. IxIlCCO
  16924. rIIE7
  16925. xCCOOoIII
  16926. //]]]]]]x]xW]xW]lWCWCWCWOxzOxzOx2
  16927. xx%%%%%%/
  16928. //////
  16929. WWWWWWW
  16930. ;IIIr
  16931. NlJoJoJlII]I]I]I]IIIIIIIIIIII7IIIIIIIIIIEIJJJJJJJJIlIkxII
  16932. //////////
  16933. /%/%%%%%%%%O7E
  16934. WWWWWW
  16935. WWWWxWWWWW
  16936. WWWWWWW
  16937. ////////
  16938. %y5E%/
  16939. /CCCOzx
  16940. -/]]xIlCOz
  16941. -]]]xIlCOz
  16942. -]]]xIlCOz
  16943. -]]]xIlCOz
  16944. -]]]xCCCOz
  16945. ;CWWx
  16946. xzxzxOCCCCCCx]xWE\
  16947.   +BiO
  16948. NorthSCRP
  16949. on mouseUp
  16950.   --visual effect scroll down
  16951.   --regionBitmapPush(the short name of me)
  16952.   answer "This region has been disabled in the demo version."
  16953. end mouseUp
  16954. --------------------------
  16955. on mouseDown
  16956.   regionBitmapDown(the short name of me)
  16957. end mouseDown
  16958. --------------------------
  16959. on mouseLeave
  16960.   regionBitmapLeave(the short name of me)
  16961. end mouseLeave
  16962. downregion
  16963. Central
  16964. leftregion    NorthWest
  16965. rightregion
  16966. GreatLakes
  16967. upregion
  16968. L{{{cc/
  16969. L{{7c//
  16970. LL{{7c//
  16971. LL{{{///
  16972. LLL{7c///
  16973. LLL{7c//
  16974. .>FFQP
  16975. LL{{7c//
  16976. .>FFFFQY]lV
  16977. LL7{7/
  16978. 8=QYdl
  16979. LL{{7c///
  16980. **FFNFTQ_cYw
  16981. =]lQl
  16982. =3'Yclx
  16983. 55/lcYy
  16984. {LL{{{{7c//c/////
  16985. LLLLL{{{{7c//c//c//c//c
  16986. ////////
  16987. ccccccc
  16988. ccccc
  16989. pLNI]L
  16990. ]cccccc
  16991. ccccc
  16992. ccccccc
  16993. cccccc
  16994. >>>>>>>_>_>_
  16995. cI<]<]]]]]]]DIU;
  16996. I(wwL">>>>
  16997. >_>_>>>>>>>3>"
  16998. I9I/UI]]IwwL">>>>_
  16999. N>cwI<]IIU7UI]]](w{>">>>_
  17000. 8>w>LtwN>>>>I
  17001. >_>>>"{w(]]]II9IUI]](ww>N>
  17002. -]]]]
  17003. _>>>>>BwwI]]II5I9I
  17004. >>>>>Bww
  17005. </c/c/{{{{{{LLLLLL
  17006. /<<<</c/c/c/c/w{{{{{LLLLL
  17007. /ccwL
  17008. 8LL{7c7LL
  17009. </w{LLL
  17010. /</c7{{LL
  17011. </c/7{{LLL
  17012. /</c//{{{LLL
  17013.     NorthWestSCRP
  17014. on mouseUp
  17015.   -- visual effect scroll right 
  17016.   -- regionBitmapPush(the short name of me)
  17017.   answer "This region has been disabled in the demo version."  
  17018. end mouseUp
  17019. --------------------------
  17020. on mouseDown
  17021.   regionBitmapDown(the short name of me)
  17022. end mouseDown
  17023. --------------------------
  17024. on mouseLeave
  17025.   regionBitmapLeave(the short name of me)
  17026. end mouseLeave
  17027. downregion
  17028. leftregion
  17029. rightregion
  17030. North
  17031. upregion
  17032. !HH]]
  17033. WQ3Z9q
  17034. uBRBRBCBC5R5RR5CRRu
  17035. -^^ss
  17036. 3QQWQ333BZuuuquuZRBRBRB5RCR5CC8CCRCR\u\u~~
  17037. |Q333ZBZBZuuZuBBRRB5CBCBCBCCCR5CCRRRR\\\u\
  17038. ZZZBZZZuZZZBBRRRBRR5RCBC5CR5CCRCRCR\R\
  17039. uZuZRBZRBBRBRRRRRRRCCRCCCCCCCCCCCC
  17040. kasO$&$
  17041. kqsO6$
  17042. asO$6$
  17043. kasO$6$
  17044. kasO66$
  17045. aasO$6$
  17046. kasO$6$
  17047. kasO$6$
  17048. kasO$
  17049. 6W6&$
  17050. sWWW$$$WWss
  17051. CWWsa
  17052. ::::::::
  17053. :>::9:::
  17054. ExIxWIlO
  17055. OE]I]]II7EE%
  17056. %%%%%%
  17057. xOE]IIIIo
  17058. zlIxWElC
  17059. //////
  17060. ]IlCIJII9II]]EI;I
  17061. J;IElC
  17062. xCEIIIEElx
  17063. ::::::
  17064. 6<<::<<
  17065. lOxC/
  17066. :::::
  17067. WWWWW
  17068. WWWWW
  17069. WWWWWW
  17070. ::::::
  17071. ::::::
  17072. <W6.OOW&$66<
  17073. qsaak
  17074. 9::::
  17075. $$&<ssqk
  17076. $$&$ssak
  17077. $$<Ossk    
  17078. $$<ssak    
  17079. $$6$ssak
  17080. $$6$sqk
  17081. $&<ssak
  17082. $$6$ssqk
  17083. $$&<sOqa
  17084. &6sOsak
  17085. $6$ssak
  17086. $$6$ssqk
  17087. $$&<sO/
  17088. $Ossa
  17089. $$6OOssk
  17090. $$<OOsaa
  17091. $66OOsak
  17092. $6$Ossak
  17093. $6.Osaa
  17094. use+BiO
  17095.     INFO
  17096. GreatLakesSCRP
  17097. on mouseUp
  17098.   visual effect scroll down
  17099.   regionBitmapPush(the short name of me)
  17100. end mouseUp
  17101. --------------------------
  17102. on mouseDown
  17103.   regionBitmapDown(the short name of me)
  17104. end mouseDown
  17105. --------------------------
  17106. on mouseLeave
  17107.   regionBitmapLeave(the short name of me)
  17108. end mouseLeave
  17109. downregion
  17110. MidAtlantic
  17111. leftregion
  17112. North
  17113. rightregion    NorthEast
  17114. upregion
  17115. Button Helpdata
  17116. Fp+o?
  17117. vvvvv
  17118. }vvvx
  17119.     {vzp?
  17120. 0>C(}(H>HF\_yy
  17121. r\ssz}
  17122. ????=
  17123. ppspps
  17124. ~~$|t$}V
  17125. <>>><
  17126. Z0FTx
  17127. IFFFX_vldG]}*
  17128. 0*8 1X
  17129. ss}}v
  17130. ~~|pTu
  17131. ?????
  17132. ?????
  17133. =**0*0
  17134. ,>N-5
  17135. ,*008
  17136. 8***,
  17137. KCaam
  17138. 8>>6,
  17139. cMe..
  17140. uu[[.
  17141. urct00=4
  17142. 6Gy{d
  17143. xLsss
  17144. 0RggmRRMMgM5
  17145. CCmfc.
  17146. M*"5}
  17147. >>>>>>>>>>0
  17148. >7<>>2
  17149. U];">{{    
  17150. ....4
  17151. 4.+++MMMl>
  17152. {>"]IU
  17153. I]/"{
  17154. {{g2"]]
  17155. I22>g{
  17156. +.7f/~p
  17157. {{1I5
  17158. 1.!!.
  17159. ~t~~~
  17160. p~pp.
  17161.     {&27{&2
  17162. MMie&$0>&$
  17163. *8!,ig~R",'
  17164. Uzc)RRg,,
  17165. 5KgYf
  17166. 0CC71
  17167. s00>g&&&
  17168.     >&&:
  17169.     >U9"
  17170.             {            {{{{{{{{
  17171. 22222222;;/]/;/]]]]]]]I9U9I9]9
  17172. A]]]I9U9I9U999I9U9IUII]]]I]]///]//"2"222&2I
  17173. ,W_Y'
  17174. ///]22"2222"
  17175. yg{{{{{{{{
  17176. 66&66&&&&&&
  17177. 15A4v
  17178. A&&&&&
  17179. )ScWz
  17180. 2.pQ}v}}}}ss{
  17181. }}}}s
  17182. &&&&&&    &&&&&{
  17183. 0>C>v
  17184. s}ss{ss
  17185. &ZUU~Ws
  17186.     {{g    0
  17187. 22;;;"2/]IU;
  17188. >2"/]IU9;UI
  17189. 9I]];"2>3
  17190. 959I]];"2    g{
  17191. >>>>>>>>>
  17192. ><$$$$$$$
  17193. I$&&{
  17194. ><<>>
  17195. on mous+BiO
  17196. MidAtlanticSCRP
  17197. on mouseUp
  17198.   visual effect scroll left
  17199.   regionBitmapPush(the short name of me)
  17200. end mouseUp
  17201. --------------------------
  17202. on mouseDown
  17203.   regionBitmapDown(the short name of me)
  17204. end mouseDown
  17205. --------------------------
  17206. on mouseLeave
  17207.   regionBitmapLeave(the short name of me)
  17208. end mouseLeave
  17209. downregion    SouthEast
  17210. leftregion
  17211. Central
  17212. rightregion
  17213. upregion    NorthEastdata
  17214. `RE<811<:<:NKNT
  17215. /c97>
  17216. I-t{N
  17217. ]k_-w{7
  17218. d`>;80....).11888<<<<N<NNNNcki
  17219. ]95>L
  17220. cc>pcc]
  17221. jgtS0
  17222. ttr_%
  17223. hwhwhwhw
  17224.  ;-vq
  17225. ccccc
  17226. cccc>
  17227. >G{I]NtctG{t$
  17228. _w{>_w{>
  17229. >{w_>
  17230. yr_W,%
  17231. >>wwrkwwLU
  17232. IcwN>
  17233. {{hQ<
  17234. ::4<<
  17235. >II{wI
  17236. ]]9(LE
  17237. >>>NwI]/
  17238. -$NLGN<]$
  17239. NE9{>>II/
  17240. ILwN>
  17241. >>>{wI]I9II]<;7
  17242. UN{NUN{N
  17243. _>>>$III
  17244. III$>>>_
  17245. >>>>c(]I]5IIIw{>>>_
  17246. >>>>cwI]I]-I]IcN>>>
  17247. _>>>>cwI]I]/UI]IcN>>>
  17248. :4:42::7
  17249. _>>>Nw(]]I]-II](cL">>>
  17250. >>>N{>{Lw(]]I9;I]](cN>>>_
  17251. >{;IN
  17252. >>>>>NwI]]-
  17253. ;II]](wL>>>_
  17254. >wwc]9
  17255. <N>>_
  17256. >_>>>NI
  17257. 9I9I]](cw>
  17258. 7{>{>>
  17259. >_>>>>"NwwwI<]]I9;]](ww>N>>>_
  17260. <7LL8
  17261. >_>>>>">cwwI<]]IIU9;III]]](wL>>_
  17262. >>>>_>>>>"{wwI<]]]IUI-I9I]]](wwwL>>>>>>_
  17263. >I;L>
  17264. E]]]/NNI]U7UII]]]<(wwN>N>>>>_
  17265. >_>>>>
  17266. ]]NN/IcwL">>>>>__
  17267. /wI<]]]I
  17268. >>>_>
  17269. >(wI;ww>
  17270. !II]]]<(ww>
  17271. /7B>>>>>__
  17272. >I;I>
  17273. >>{I9L>
  17274. LLL{{7L
  17275. LL{{7c/c/<<
  17276. LLLL{
  17277. LLBp//
  17278. <pc{L
  17279. L{pc/
  17280. LLL{L7c
  17281. ;r{L7c<<<
  17282. LLL{{7<
  17283. LLLL{{{7c/c/<<
  17284. U+BiO
  17285.     SouthEastSCRP
  17286. on mouseUp
  17287.   visual effect scroll up
  17288.   regionBitmapPush(the short name of me)
  17289. end mouseUp
  17290. --------------------------
  17291. on mouseDown
  17292.   regionBitmapDown(the short name of me)
  17293. end mouseDown
  17294. --------------------------
  17295. on mouseLeave
  17296.   regionBitmapLeave(the short name of me)
  17297. end mouseLeave
  17298. downregion
  17299. Button Trivia
  17300. leftregion
  17301. South
  17302. rightregion
  17303. upregion
  17304. MidAtlanticdata
  17305. -/-//&0/
  17306. /$$<    
  17307. E    $$y
  17308. -/-/&$<p
  17309. >/-]/$$<    
  17310. -/&$<    
  17311. >-/-]//&$$<<    
  17312. >9I0    y
  17313. ]//&$$<        
  17314.     I99I7    
  17315. ----/-////&$$0<    <    9
  17316. ;                
  17317. $$$]]
  17318. $$$$$
  17319. $$$$$$
  17320. rrmmmmmmmwmmmwmmmmmmjmwmmmmmmjmmwmmmmmmmmmm
  17321. <001=
  17322. 63633
  17323. e0y0A
  17324. 4j^mj
  17325. yyye    
  17326. yyye    
  17327. $0;;]]IU9;-IU
  17328. yyyyye    y    p
  17329. 34631
  17330. y        00;;]]IU97-III]/;200    yeI
  17331. yyyyye    y    0000;;/]]]]IU9I9/
  17332. p959III]/;20<    yyyr
  17333. U/]]]]IU9I999I9II]]]//;200
  17334. ;3363
  17335. yyyy                        <0$$$y
  17336. <    yyyr
  17337. II]]]//;2000        y    rrryy            
  17338. E<    0y
  17339. I3<<<<<
  17340. <<0<<<
  17341. 200<+
  17342. $=2'+
  17343. h<N<T
  17344. *CM[^iv
  17345. ppppp
  17346. 0222222
  17347. 2222222
  17348. (~iiF3$$<
  17349. 6PPPf
  17350. 66:26
  17351. >333<<
  17352. <111?
  17353. WCcopyrightdata
  17354. y}yyy
  17355. !:Q:!
  17356. PU3r9|-
  17357. ?c(g\
  17358. qqqq<H
  17359. ]I%%O]
  17360. }}}}}
  17361. l%%//
  17362. D]11JI
  17363. OAnc&(
  17364. /CW}H$C
  17365. #TAIL
  17366. on mouseU+BiO
  17367.     NorthEastSCRP
  17368. on mouseUp
  17369.   visual effect scroll left
  17370.   regionBitmapPush(the short name of me)
  17371. end mouseUp
  17372. --------------------------
  17373. on mouseDown
  17374.   regionBitmapDown(the short name of me)
  17375. end mouseDown
  17376. --------------------------
  17377. on mouseLeave
  17378.   regionBitmapLeave(the short name of me)
  17379. end mouseLeave
  17380. downregion
  17381. MidAtlantic
  17382. leftregion
  17383. GreatLakes
  17384. rightregion
  17385. upregion
  17386. Button Helpdata
  17387. $6$kas$
  17388. sWWW$
  17389.                     
  17390.     yLAQ
  17391. $6$Osa
  17392. AEZZ*
  17393. $6$Osak
  17394. /<WWxk
  17395. aWWW/
  17396. $$6</
  17397. $$6$ssakx;I
  17398. &6$ssak
  17399. ^RTM+dNWC
  17400. kWWE*
  17401. CoEI7E]x<
  17402. ]IEIIJElx
  17403. /COC`
  17404. kWWE%
  17405. 72(/mj
  17406. IEI`O
  17407. /0*0*=
  17408. :::::
  17409. WWWWW]
  17410. $<COa
  17411. CCW(WWCO
  17412. xOEErOOO
  17413. WNniHQ
  17414. xOE]/EE
  17415. CEE;EE]
  17416. $WWWW
  17417. I]IIE`C
  17418. :bo=97
  17419. s>>HHFN    
  17420. lQ{)&S
  17421. OOEIl
  17422. OOEEI
  17423. OOEEI
  17424. EE`CO
  17425. OOEEI
  17426. EE`CO
  17427. OOEEI
  17428. EE`CO
  17429. OOEEI
  17430. EE`CO
  17431. OOEEI
  17432. EE`CO
  17433. EE`CO
  17434. :ffhfhhhhhh
  17435. 74155
  17436. 74515
  17437. kWWWaWWW
  17438. kaOW<
  17439. ksOCW<6
  17440. qsCW<$
  17441. asCWW&$
  17442. asOWW6$
  17443. VINFO
  17444. >CARD
  17445. National_hilitedata
  17446. UTAIL
  17447. PUR+TXT
  17448. >INFO
  17449. keydata
  17450. northwestTAIL
  17451. on mous+BiO
  17452. UINFO
  17453. West_hiliteSCRP
  17454. on mouseUp 
  17455.   --visual effect scroll right
  17456.   --go to card "West"
  17457.     hide me
  17458. end mouseUp
  17459. 9::::
  17460. ;IUIIlC
  17461. II9IIlO
  17462. "EU]IEl
  17463. ::::::
  17464. IE9IIlO
  17465. ;E9IIEl
  17466. IE9IIlx
  17467. II8IElx
  17468. 5I8IIlC
  17469. "II9IIlO
  17470. II5]IElx
  17471. IEU;IElO
  17472. IIlOx
  17473. "II9]IIlC
  17474. qqqqvqv
  17475. ;II9IIElO
  17476. ;EU7I]lCC
  17477. IU9IIIlCO
  17478. IIIlO
  17479. ;II5]I]oCO
  17480. "]JU5]IIx]
  17481. I]](wN>>>>
  17482. ;]]UU9]]]Iw{>>>>
  17483. /]IU9]]]]
  17484. MMP`-3.
  17485. zzmma
  17486. ;N]A99II];
  17487. ;]IU;9I]]6
  17488. "]]AI99I];
  17489. 3:41888
  17490. 48888388
  17491. 888888
  17492. 88888
  17493. <:1:1
  17494. 88888
  17495. 8<<88<>
  17496. <>>6>>
  17497. 88888
  17498. 8<<888888
  17499. 88:<>6
  17500. >6>6>66
  17501. 8<:4<16>6>
  17502. 888888
  17503. 8<88<1:>:>>>:>
  17504. 8:8>8<
  17505. q*++2 92
  17506. YMYMMM
  17507. Y[[[[^7-
  17508. MMMMMM
  17509. p~322
  17510. 66666
  17511. ivvvivvv
  17512. v777^
  17513. MMMMMMMM
  17514. vvvvvvvvvvvvvv~~
  17515. 7[[Mp=32.
  17516. (((70
  17517. +.+?D
  17518. %2:*J
  17519. ~pp~pppp
  17520. ppp~~p
  17521. pqpqpq
  17522. ~sx]+
  17523. ~pp~~~
  17524. ~~~~~p~~~~~~
  17525. -111;
  17526. kgX4 
  17527. ~~p~~p
  17528. ~pp~~~pp
  17529. ~p~~~
  17530. ~~~~~~~~
  17531. ~~~~~~~
  17532. S"<@[qFXH
  17533. ~~~~~~~
  17534. ~~~p~
  17535. <>666>
  17536. ~~~~~~~~~
  17537. ~~~~~~~
  17538. -<?++!
  17539. ~~~~~~~
  17540. 2<?!!!
  17541. ><9+!!
  17542. -000X^
  17543. 0rtt^qq
  17544. s[WV%
  17545. &&Xrs
  17546. n+BiO
  17547. MINFO
  17548. northwest_hiliteSCRP
  17549. on mouseUp
  17550.   --hide cd grp "Cities" of cd "NorthWest"
  17551.   -- visual effect scroll right
  17552.   --go to card "NorthWest"
  17553.     hide me
  17554. end mouseUp
  17555. !!HH=H]HH=H!!
  17556. !!HH=H]H==H!
  17557. !H!H==!!
  17558. 3WssWQ333Buq
  17559. xuZRRR8R8R5R8R5RCRRR\u~~
  17560. h\\KKCCIIIIIIIIKac
  17561. =5miui
  17562. |iu!i=
  17563. =T=i!
  17564. sQ333ZBBZuZuuZBBRRBBCBCBCBCCCR5CCRRRR\\\u\u\\\\YCCICCCIICIIIIIIIKaccffffcccccf}
  17565. (:(Yccc
  17566. IIIIIIIIIIIIII
  17567. ]x]]-
  17568. >::>::
  17569. lxIxxC
  17570. II]I]]I7EE
  17571. `5IIIIIl
  17572. ox]xl
  17573. UIIlCIIII;J]]]IE;I
  17574. I7IEl
  17575. `EE;EE`
  17576. `EE;EIl
  17577. :::::
  17578. p>w>>{w>>>>>I
  17579. I]]]]
  17580. l]]]]]
  17581.     ::
  17582. :9:< # &
  17583. 2II9IIl
  17584. {y>"E5IIE
  17585. 2IE9IIl
  17586. {g>;E5IIE
  17587. 2IE9II`
  17588. "IY7IE
  17589. 5E8IIl
  17590. k1"II9II`
  17591. 2IE9II`
  17592. 2IEU;IE
  17593. {{g2;EY
  17594.     {w>"II9
  17595. ``d`--)*
  17596. {{g2IIU
  17597. {{g2"II5]IIl
  17598. &;II9IEE
  17599. 27EY7I]lC
  17600.     {g    U
  17601. IU5IIIl
  17602. 2"IIY
  17603. {{g>2;IEU]IIo
  17604. {{g&"IJU5IIIx]]
  17605. TINFO
  17606. South_hiliteSCRP
  17607. on  mouseUp
  17608.   --visual effect scroll up
  17609.   --go to card "South"
  17610.   hide me
  17611. end mouseUp
  17612. rightregion
  17613. WWWWWWWWWW
  17614. WWWWWW
  17615. -lCOx
  17616. ]IIY;IIIIxElC
  17617. ((I]EIUIIIIIxElC
  17618. ((I]EIUIIIIIxElC
  17619. ((I]EIUIIIIIxElC
  17620. (II]EI9IIIIIxCCO
  17621. (II]II5IIIIIxIlCOCC%r
  17622. pIUI9
  17623. +J+J+J+J+J+III]I]I]I]IIIIUIUIUIUIUI]]I]I]I]I]IIJJJJJJJJJJJIlIx
  17624. ]NN]]<](
  17625. zOCCOCCxIxWE/
  17626. ]]/N<]]]IIUI97]9IUINN]]<](
  17627. CCOCCC`]xWIIIIIIEIIIII9E9IYII]I]
  17628. (N/]]]]I9
  17629. IIIIIII;IYI9IE]]]II(I(I$
  17630. ]]](IP
  17631. I]]]]
  17632. (]<AE
  17633. (]]]<]-I
  17634. I]]]]]]I/I
  17635. (<U;I;I
  17636. I<]<]<]
  17637. /]IIUI9II9I7UII9IIUII]]]]]]
  17638. $$$$$$
  17639. :II]]](
  17640. ]A]]](
  17641. (]]]IIU
  17642. I9I]]]<(
  17643. (]]]]IIU;I9I]]](
  17644. 3!!!!!
  17645. (]]]IIU;
  17646. 4<55!!!!
  17647. ~sss[`
  17648. 11;;F
  17649. sss``
  17650. 1.1188
  17651. 8111.
  17652. yyyyyy    e    y    <000y
  17653. ]//]]]]]I9U9I97UI
  17654. I]]]]<]<](
  17655. ););)
  17656. I]]<fA
  17657. I]]]I
  17658. 88865!+!
  17659. !!!!!!
  17660. =CMM[i
  17661. 11111
  17662. qpppp
  17663.     kikpp
  17664. p}}pkkkUikkiiiU
  17665. UUUUiUUUUUXUUUUUU
  17666. 22222
  17667. UUUUUUUUUUUUUU
  17668. ..22==LLM-
  17669. ||||||
  17670. ~dd,(46
  17671. UXXi!
  17672. GASGUAUXXk
  17673. GAG@UOUUXkt
  17674. @G@GAUUOXik
  17675. G@@@GGOOXXkkp
  17676. @@AAAUAXXipp
  17677. @@@AAUAXXkt
  17678. @GAAAAUXikt
  17679. @GAUAOXXXkt
  17680. @AUUXXkp
  17681. on m+BiO
  17682. SINFO
  17683. Central_hiliteSCRP
  17684. on mouseUp
  17685.   visual effect zoom open
  17686.   go to card "Central"
  17687.    hide me 
  17688. end mouseUp
  17689. IUI]]]]]]]///]//"2222222I
  17690. yg{{{{{{{{
  17691. 66&66&&&&&&
  17692. wwwwwN>">">>>>>>_>__
  17693. ]kN]]]]IIIIII9IUIUINNN]]<]<<wwwwN>">">>>>>>_>__
  17694. lNkD]]]]]]IIII5IUIUJNNN]]<]<<_
  17695. oNkD]]]]]
  17696. E9]]NN
  17697. I]xN9>>{]<]N_
  17698. &&&&&&    &&&&&{
  17699. ]]]:(
  17700. ](wwN>>>>>_
  17701. II9II]]](wwN>>>>>_
  17702. /UIIr
  17703. a>>>_
  17704. Cx]]III;UII]](wwL">>>>_
  17705. l]]III7I5
  17706. /IxIl
  17707. lWI]IIII7IIEEIJxIl
  17708. `CJ]I
  17709.             {            {{{{{{{{{
  17710. 22222222"{
  17711. E922;;/]/;/]]]]]]]]I5U5I9Y59IIIIIIII
  17712. III]]]I]]x]x]x]xl
  17713. NIJJJJJIlIxx]xx]xl
  17714. NlJoJoJlII]]]]]]]IIIIIIIIIIII7IIIIIIIIIIEJJJJJJJJJIlIkxII
  17715. ]AI2{
  17716. OI9I{
  17717. EU;IIIIkl
  17718. kw"(((INIEUIIIIIkl
  17719. kkkkw""((INIEUIIIIIkl
  17720. kkkkw""((INIEUIIIIIkl
  17721. kkkkw""(IINIE9IIIIIxC
  17722. kkkkk
  17723. ""(II]IE9IIEIkIxC
  17724. ]ppUI99
  17725. kkkkk
  17726. kkkkkk
  17727. ]NN]]]<I"""".kwkwkkkkkk
  17728. lCIxxE
  17729. ]]/N<]]]IIUI97]U]UINN]]]<I""k
  17730. lx]xxIIIIIEIIIIIII9EIYIII]
  17731. kkkkkwk
  17732. 6"6"I/N<]]]I9
  17733. IIIIIII;EUE9EI]]]]I(I(I$""""""k
  17734. kkwkkkk.
  17735. kkkap
  17736. I("""""
  17737. kkkkkka
  17738. on mou+BiO
  17739. NINFO
  17740. North_hiliteSCRP
  17741. on mouseUp
  17742.   --visual effect scroll down
  17743.   --go to card "North"
  17744.     hide me
  17745. end mouseUp
  17746. (]]]-
  17747. (]]]-
  17748. (]]]!
  17749. *>FTP_{x
  17750. (]]]!
  17751. *>HFTTPW]lV
  17752. (]]]A/
  17753. FFFTE_NmVv
  17754. '_lYx
  17755. pIIU-
  17756.     8    3]lQl
  17757. rIIU/
  17758.     33'Yclx
  17759. 55/lcYy
  17760. (]<]<]]]]]]]]]]A]-]A]-]
  17761. I]]]]]]<]<](
  17762. I<]<]]]]]]]DIIU9
  17763. IIU;]I]]I
  17764. I<]IIU7]I]]](
  17765. (]]]II9IUI]](
  17766. E]]]]
  17767. (]]II9]II
  17768. ]x]IlOx]]]]
  17769. I%/%%/
  17770. A]]]I9U
  17771. ///]222
  17772. -]N]]<](
  17773. ]xN]]]]IIIIII9IUIUINNN]]<]<(
  17774. %%%%%%
  17775. CCCCClNkD]]]]]IIIII5IUIUINNN]]<]<(
  17776. %///////
  17777. //%%%%%
  17778. OCCCClNkD]]]]]
  17779. //////
  17780. //%%%%
  17781. J:/NI
  17782. /////
  17783. JNkI9
  17784. I]I9(
  17785. &;]]UU;UI]I
  17786.     {{wg22;]IU9]]]](
  17787. I;II]]](
  17788. CCl]x]III;II]]](
  17789. CCCx]]III;IUE]](
  17790. CCCO]]III7I5I]](
  17791. OCOl]]III7I5
  17792. /IxIlCCO
  17793. xCOl]l]IIII7IIEEJIlIlC
  17794. xCCOOoIII
  17795. o+BiO
  17796. OINFO
  17797. greatlakes_hiliteSCRP
  17798. on mouseUp
  17799.   visual effect scroll down
  17800.   go to card "GreatLakes"
  17801. end mouseUp
  17802. pw+KKQMr
  17803.     qtVp>
  17804. }vvvx
  17805.     {vzp?
  17806. b~jg5&
  17807. 0C>X}%Z,ZTXZyy
  17808. r\ssz}
  17809. ????=
  17810. ppspps
  17811. ~~$|t$}V
  17812.                     
  17813. _0FTx
  17814.                     
  17815. *bv"C
  17816. 0FFFFXlvldG]}*
  17817. I-A-]-
  17818. *0*8 1X
  17819. ss}}vv
  17820. I-]A;
  17821.                     
  17822. ~~|pTu
  17823.                     
  17824. ?????
  17825.                     
  17826. sKWsis
  17827.                     
  17828. 0*Cag
  17829. ,>N-5
  17830. >O~Qo
  17831. &&&0*
  17832. }08-]
  17833. urct00=4
  17834. 6Gy{d
  17835. 0RggmRRMMgM5
  17836. 9]]]]
  17837. qaaaq!
  17838. gaaCMMMMl>
  17839. 6]IU;I]/"
  17840. gMB"RRB
  17841. /]aaa$~ppp
  17842. ~[44a3!@
  17843. ~t~~~
  17844. a_>_acL
  17845. <333R
  17846. ~~~R,,'
  17847. OJ#'"Kg~$
  17848. ]<]<(wwwI
  17849. ]-a3333
  17850. ss}vv
  17851. ]]]]DIUI5
  17852. +gKgWf
  17853. >>>>3>">|
  17854. 0CC71
  17855. K0CC"k
  17856. 0Z@So
  17857. M5?70]
  17858. ;]6/]6/]]]]]]]IU9I9]99
  17859. A]]]IU9I9]9]-9I9U9IUI]]]]]]]///]//"
  17860. ,W_Y'
  17861. w{LL;E    
  17862. ixxvCH
  17863. 15A4v
  17864. 2.pQ}v}}}}ss{
  17865. }}}}s
  17866. s}ss{ss
  17867. &ZUU~Ws
  17868. "/]IU]
  17869. 8*"*"
  17870. "/]IU9;UI
  17871. 9I]];
  17872. 959I]];
  17873. EIpIE
  17874. II]]]]]]]x]x]x]xlOCCCCCCC
  17875. E%%%%%%%%/%/
  17876. ////////
  17877. IIEIJJJJJJJJIlIkxII
  17878. CCOlJoJoJoJoIIIN]II]
  17879. /%/%%%%%%%%O7E
  17880. ////////
  17881. U/|I>
  17882. /6]<9I
  17883. I/U>_
  17884. I5>ww{
  17885. >_>wIar
  17886. IkL9]"N9/wNwL
  17887. %y5E%/
  17888. >_>II>Lw>U
  17889. >II9ILU
  17890. >II{wI
  17891. 9II<I
  17892. ;>LIN    
  17893. ]]9(LE
  17894. %OI9I
  17895. >>_>(]
  17896. NE9{>>II/
  17897. ILwN>
  17898. _N55N
  17899. >>cw>
  17900. >>>N{>{Lw(]
  17901. >{;IN
  17902. >>>>>NwI]]-
  17903. pwwI]]I]9I
  17904. -]](www>>>
  17905. >_>>>NI
  17906. 9I9I]](cw>
  17907. >_>>>>"NwwwI<]]I9;]](ww>N>>>_
  17908. >_>>>>">cwwI<]]IIU9;III]]](wL>>_
  17909. on+BiO
  17910. RINFO
  17911. SouthEast_hiliteSCRP
  17912. on mouseUp
  17913.   visual effect scroll up
  17914.   go to card "SouthEast"
  17915. end mouseUp
  17916. <www_
  17917. >ww{pww{N
  17918. ]<(ww_
  17919. >I;I>
  17920. >>{I9L>
  17921. _>>>>>NwwI>U
  17922. >>{w(]]]]]999
  17923. >{II59I]]//
  17924. >>>>>N{>
  17925. NwwI]]]]5
  17926. >>{E9
  17927. ;99II]//
  17928. ;;IL>
  17929. >>>>NwwI]
  17930. NwwI]I]99I
  17931. >_>>>>NwwI<
  17932. 5]99II];
  17933. >_>>>>"NwwwI<]]]]99IU]];
  17934. pIIU9
  17935. 9]9IpI
  17936. >>">NwwwI<]]]I]U99IUI]]/;
  17937. ]]I]U]59I9I
  17938. -AA]]]]//;
  17939. mghc*;-(
  17940. kwk.""""""""I<]<]<]
  17941. 9I9Il
  17942. """""
  17943. kwkkkkkkk;U
  17944. 63633
  17945. ;]]]IU9;9IU
  17946. 34631
  17947. ;]]]IU979II]]/;
  17948. ;]6/]]]IU]993
  17949. U9I]]/;
  17950. ]/]]]]IU9I99I9II]]]]//;
  17951. I]]]]//;
  17952. I]]]]<]<](("""".k}
  17953. kkkkk
  17954. ]|]]I
  17955. 200<+
  17956. 20000
  17957. 20000
  17958. $=2'+
  17959. pp~~ppp
  17960. **=&J
  17961. `[G*;-(
  17962. 222272727
  17963. ppppp
  17964. Y[k$;-
  17965. UHpT$>-
  17966. 2222222
  17967. 7<'<*
  17968. 708<*
  17969. >333<<
  17970. +?gS^@0
  17971. s2$hciT*;
  17972. GGUAGUUUUXikt
  17973. triXUUGUG@UGGUG
  17974. QINFO
  17975. MidAtlantic_hiliteSCRP
  17976. on mouseUp
  17977.   visual effect scroll left
  17978.   go to card "MidAtlantic"
  17979. end mouseUp
  17980. A]IEnk{{    
  17981. &&/-]&&&{
  17982. 2>g{{{    
  17983. &&]]y
  17984. &&&&&&
  17985. OCoIN
  17986. ClIII7IJI%
  17987. zC`III;II(
  17988. zC`N]9IEI(
  17989. OC`N]
  17990. OOEI]
  17991. COII]
  17992. ;IEI7I
  17993. /6]<9Iy
  17994. E{{{        {
  17995. I99E{U5
  17996. I;9I.
  17997. {g{{]
  17998. {IA]J
  17999. 222I-I>E
  18000. 9II<I
  18001. I]I9;
  18002. I]I9II](
  18003. (]II5III
  18004. I]II9I]I
  18005. {2I9-I
  18006. (]]II9II](
  18007. (]]I9;I]](
  18008. I]]-;I
  18009. ;II]](
  18010. 9I9I]](
  18011. I<]]I9;]](
  18012. I<]]III9;III]]](
  18013. I<]]]IIU;IUI]]](
  18014. E]]]<]]IIU7UII]]]<(
  18015. ]]]]<I
  18016. I<]]]I
  18017. /UIII]]]<(
  18018. (]]]I]999
  18019. II59I]]/;&0
  18020. I0        yyy    
  18021. (]]I]
  18022. ;99II]/;&<;9E
  18023. ;00    yyy    
  18024. I]II99I
  18025. 5]99II];00    
  18026. y<59(
  18027. I<]]I]99II]];$0
  18028. I<]]I]]99I9I]
  18029. -;$0    yyyy
  18030. I<]]]I]U;9IUI]]/;&$0    y    yy95
  18031. >9I0    y
  18032. -]9E5Ipr72y
  18033. y    00E    00<
  18034.     y$$$]
  18035. eyyyy    
  18036. on+BiO
  18037. PINFO
  18038. northeast_hiliteSCRP
  18039. on mouseUp
  18040.   visual effect scroll left
  18041.   go to card "NorthEast"
  18042. end mouseUp
  18043. }}}}}
  18044.                     
  18045. B*&)\
  18046.                                 
  18047.                     
  18048.                     
  18049. vEZF.
  18050. pEHZ*
  18051. pEHZ*
  18052. GOCDZ*
  18053. ss}vv
  18054. `EI7E]%
  18055. ]IEIIEE
  18056. Wg030*
  18057. psU0*
  18058. ]]]#gM
  18059. o/EH'
  18060. :bo=97
  18061. s>>HHFN    
  18062. ::lQ{)&S
  18063. \f4:4
  18064. :ffhfhhhhhh
  18065. 74155
  18066. 74515
  18067. E]I]C
  18068. `III7YII"
  18069. `III;EI(wL">r6
  18070. ! -&-
  18071. `]];IEI(wL>>_
  18072. rytwwh%&
  18073. wwwwL
  18074. ~`J8888.1111:<<:N<NTTcTckk
  18075. dMB8821..1.115<:<<NNNNNTTct
  18076. ]II$wL>>>E
  18077. LI;{NL
  18078. >N79r
  18079. $INFO
  18080. Portland_icondata
  18081. 6VV0V66
  18082. iTV=g
  18083. VT3Ti
  18084. =!=!3!3!!!!!=!3==
  18085. nddata
  18086. Portlanddata
  18087. 79/62ADDD
  18088. 'INFO
  18089. Bismarck_icondata
  18090. WINFO
  18091. Bismarckdata
  18092. 55/33ADDD
  18093. *INFO
  18094. Chicago_icondata
  18095. Chicagodata
  18096. 55/31ADDD
  18097. -INFO
  18098. Boston_icondata
  18099. 6VV0V66
  18100. iTV=g
  18101. VT3Ti
  18102. =!=!3!3!!!!!=!3==
  18103. !INFO
  18104. Bostondata
  18105. 51/29ADDD
  18106. %INFO
  18107. SanFrancisco_icondata
  18108. $TT1    
  18109. /-H!H
  18110. SanFranciscodata
  18111. 58/45ADDD
  18112. (INFO
  18113. Denver_icondata
  18114. 6VV0V66
  18115. iTV=g
  18116. VT3Ti
  18117. =!=!3!3!!!!!=!3==
  18118. !+TXT
  18119. Denverdata
  18120. 56/34ADDD
  18121. +INFO
  18122. Atlanta_icondata
  18123. H/H!!H!H!H!
  18124. H!/H!/(H
  18125. .INFO
  18126. WashingtonDC_icondata
  18127. H!33H
  18128. "INFO
  18129. WashingtonDCdata
  18130. 60/36ADDD
  18131. &INFO
  18132. LosAngeles_icondata
  18133. $TT1    
  18134. /-H!H
  18135. LosAngelesdata
  18136. 64/55ADDD
  18137. )INFO
  18138. Albuquerque_icondata
  18139. 6VV0V66
  18140. iTV=g
  18141. VT3Ti
  18142. =!=!3!3!!!!!=!3==
  18143. ,INFO
  18144. NewOrleans_icondata
  18145. 5TTTi3T
  18146.  INFO
  18147. NewOrleansdata
  18148. 76/59ADDD
  18149. !3+BiO
  18150. /INFO
  18151. Orlando_icondata
  18152. 6VV0V66
  18153. iTV=g
  18154. VT3Ti
  18155. =!=!3!3!!!!!=!3==
  18156. #INFO
  18157. Orlandodata
  18158. 86/65ADDD
  18159. !3!3!+TXT
  18160.     DayOfWeekdata
  18161. As of Tuesday, December 27, 1995 TAIL
  18162. Atlantadata
  18163. 69/52ADDD
  18164. #+TXT
  18165. eINFO
  18166. WCdatadata
  18167. 8/16/94
  18168. ABQ    62    92    PC    63    93    ISTRW    63    94    ISTRW    63    93    ISTRW    63    93    ISTRW
  18169. ABR    64    84    MCLDY    63    85    PC    62    78    PC    55    82    PC    56    85    PC
  18170. ACY    65    75    PC    74    80    SCTRW    74    84    SCTRW    74    85    ISTRW    74    84    SCTRW
  18171. ALB    56    75    MCLDY    65    76    TRW    65    76    SCTRW    66    84    ISTRW    66    76    SCTRW
  18172. ALO    64    85    PC    65    85    ISTRW    65    83    SCTRW    64    78    PC    58    85    PC
  18173. AMA    65    95    PC    65    95    PC    65    95    PC    66    95    PC    65    95    PC
  18174. APN    56    80    SHW    56    78    ISTRW    61    78    SCTRW    59    75    AMSHW    55    75    PC
  18175. ATL    69    85    SCTRW    66    85    PC    66    86    ISTRW    68    87    ISTRW    72    86    SCTRW
  18176. BGR    55    74    MCLDY    57    76    SCTRW    58    75    SCTRW    62    83    ISTRW    65    75    SCTRW
  18177. BHM    66    86    ISTRW    66    85    PC    66    88    ISTRW    68    94    ISTRW    74    85    SCTRW
  18178. BIS    59    79    MCLDY    56    85    PC    56    82    PC    55    85    PC    56    86    PC
  18179. BNA    64    85    PC    65    85    PC    65    92    PC    66    93    SCTRW    74    85    SCTRW
  18180. BNO    47    82    SUN    47    84    PC    47    86    PC    47    84    PC    47    81    PC
  18181. BOI    52    86    SUN    52    91    PC    54    93    PC    57    91    PC    53    84    PC
  18182. BOS    62    75    MCLDY    65    77    TRW    66    76    SCTRW    66    84    ISTRW    67    76    SCTRW
  18183. BRL    64    85    MCLDY    65    85    ISTRW    65    85    SCTRW    66    83    PC    64    85    PC
  18184. BRO    75    96    MCLDY    78    95    PC    79    96    PC    80    96    PC    79    96    PC
  18185. BTV    53    74    MCLDY    63    76    TRW    62    75    SCTRW    64    82    SCTRW    65    75    SCTRW
  18186. BUF    61    76    MCLDY    65    84    SCTRW    65    80    ISTRW    64    84    SCTRW    65    75    PC
  18187. BZN    44    85    PC    48    79    PC    50    85    ISTRW    51    86    ISTRW    49    78    ISTRW
  18188. CAE    74    84    SCTRW    72    85    ISTRW    71    85    ISTRW    73    92    ISTRW    73    90    SCTRW
  18189. CAR    54    74    PC    55    75    SCTRW    55    75    SCTRW    57    82    ISTRW    63    73    SCTRW
  18190. CHA    65    85    SUN    65    84    PC    66    86    ISTRW    66    88    ISTRW    71    85    SCTRW
  18191. CHS    72    85    R    74    85    SCTRW    72    85    SCTRW    74    89    ISTRW    73    89    SCTRW
  18192. CLE    58    82    MCLDY    65    84    ISTRW    65    84    ISTRW    65    84    SCTRW    65    77    PC
  18193. CLT    71    79    SCTRW    66    84    ISTRW    67    85    ISTRW    70    87    ISTRW    72    86    SCTRW
  18194. COS    61    92    PC    54    88    PC    61    92    ISTRW    57    90    ISTRW    58    91    ISTRW
  18195. CSG    73    86    R    68    85    ISTRW    68    88    ISTRW    73    93    ISTRW    74    88    SCTRW
  18196. CVG    58    85    PC    65    85    PC    65    85    ISTRW    65    85    SCTRW    67    84    PC
  18197. CYS    56    86    PC    54    87    PC    55    85    ISTRW    55    85    ISTRW    56    88    ISTRW
  18198. DCA    67    76    PC    73    83    SCTRW    73    84    SCTRW    73    85    ISTRW    73    85    SCTRW
  18199. DEN    62    93    PC    54    92    PC    62    92    ISTRW    58    86    ISTRW    58    92    ISTRW
  18200. DFW    73    95    PC    74    95    ISTRW    74    95    PC    75    96    PC    75    97    PC
  18201. DLH    56    75    PC    55    78    ISTRW    58    75    SCSW    56    75    PC    54    78    PC
  18202. DRT    74    97    SUN    75    104    PC    75    104    PC    75    104    PC    75    104    PC
  18203. DSM    65    85    PC    65    85    ISTRW    65    84    SCTRW    65    84    PC    64    85    PC
  18204. DTW    57    84    PC    65    84    ISTRW    65    84    ISTRW    64    82    SCTRW    63    76    PC
  18205. ELP    72    96    SUN    71    101    ISTRW    72    103    ISTRW    73    102    ISTRW    72    102    ISTRW
  18206. ELY    49    94    SUN    51    90    PC    57    95    PC    51    92    PC    49    87    PC
  18207. EUG    53    73    PC    54    74    PC    53    75    PC    54    77    VCLDY    53    74    SCSW
  18208. EWR    63    74    PC    70    77    TRW    69    83    SCTRW    71    85    ISTRW    72    82    SCTRW
  18209. EYW    81    89    PC    80    87    SCTRW    78    89    SCTRW    82    86    SCTRW    81    87    SCTRW
  18210. FAR    64    76    PC    57    84    ISTRW    63    75    PC    55    76    PC    55    85    PC
  18211. FAT    70    102    SUN    61    92    SUN    62    96    SUN    62    92    PC    62    92    PC
  18212. FLG    58    89    ISTRW    59    89    ISTRW    59    89    ISTRW    59    90    ISTRW    59    90    ISTRW
  18213. FMY    77    92    ISTRW    75    91    SCTRW    75    93    SCTRW    75    92    SCTRW    75    93    SCTRW
  18214. FSD    65    85    PC    64    86    ISTRW    65    82    ISTRW    57    84    PC    56    85    PC
  18215. FWA    56    85    PC    65    85    PC    65    85    ISTRW    65    80    SCTRW    65    83    PC
  18216. GCK    65    94    ISTRW    64    95    PC    65    94    PC    65    93    PC    65    94    ISTRW
  18217. GDV    56    84    PC    55    85    PC    55    85    PC    56    86    PC    63    89    PC
  18218. GEG    52    77    PC    53    78    PC    54    85    PC    55    85    PC    54    81    PC
  18219. GFK    61    76    MCLDY    55    83    ISTRW    56    75    PC    53    76    PC    55    85    PC
  18220. GJT    62    90    SUN    60    92    PC    61    91    ISTRW    61    92    ISTRW    61    91    ISTRW
  18221. GTF    51    85    PC    51    82    PC    51    85    PC    54    87    PC    55    83    PC
  18222. HOU    75    95    ISTRW    76    95    ISTRW    76    95    ISTRW    76    95    PC    76    95    ISTRW
  18223. IND    56    85    PC    65    85    PC    65    85    ISTRW    65    84    SCTRW    65    84    PC
  18224. INL    54    74    PC    54    76    ISTRW    56    73    SCSW    53    75    PC    54    76    PC
  18225. ISN    55    80    MCLDY    55    85    PC    55    81    PC    55    85    PC    57    85    PC
  18226. JAX    73    87    PC    75    86    SCTRW    73    88    SCTRW    75    91    ISTRW    75    88    SCTRW
  18227. LAS    80    107    SUN    81    105    SUN    79    106    SUN    77    106    SUN    79    105    PC
  18228. LAX    65    87    SUN    68    88    ACLPS    69    85    ACLPS    73    82    ACLPS    67    81    PC
  18229. LBB    65    95    PC    65    95    PC    66    96    PC    68    99    PC    72    95    PC
  18230. LBF    65    94    PC    56    94    PC    64    86    PC    64    85    PC    64    87    ISTRW
  18231. LEX    63    85    MCLDY    65    85    PC    65    85    ISTRW    66    88    SCTRW    72    85    ISTRW
  18232. LIT    65    86    PC    65    91    PC    66    94    PC    74    93    SCTRW    74    86    SCTRW
  18233. LSE    63    84    ISTRW    63    85    ISTRW    65    81    SCTRW    64    76    PC    56    84    PC
  18234. LWS    53    83    ISTRW    54    83    PC    54    88    PC    55    84    PC    54    84    PC
  18235. MAF    66    95    PC    67    97    PC    73    103    PC    74    104    PC    74    102    PC
  18236. MCI    65    92    PC    65    86    ISTRW    66    93    SCTRW    71    85    PC    65    85    PC
  18237. MEM    65    85    PC    65    86    PC    65    94    PC    72    94    SCTRW    74    86    SCTRW
  18238. MIA    78    89    R    78    87    SCTRW    78    88    SCTRW    80    87    SCTRW    79    87    SCTRW
  18239. MLS    55    84    PC    55    85    PC    55    85    PC    56    87    PC    64    92    PC
  18240. MOB    72    88    ISTRW    74    86    ISTRW    74    89    ISTRW    74    90    ISTRW    73    86    SCTRW
  18241. MQT    55    75    ISTRW    55    76    ISTRW    57    75    SCTRW    56    69    PC    47    75    PC
  18242. MSP    64    79    ISTRW    63    84    ISTRW    64    76    SCTRW    56    76    PC    55    84    PC
  18243. MTN    65    76    SCTRW    73    83    SCTRW    73    84    SCTRW    73    85    ISTRW    73    84    SCTRW
  18244. NEW    73    93    PC    74    88    ISTRW    74    90    ISTRW    75    91    ISTRW    74    88    ISTRW
  18245. NGP    75    95    SHW    77    95    PC    77    95    PC    77    96    PC    77    96    PC
  18246. OMA    65    86    PC    65    86    ISTRW    65    85    SCTRW    65    85    PC    64    85    PC
  18247. ORD    62    84    PC    65    85    ISTRW    65    85    SCTRW    65    76    AMSHW    63    80    PC
  18248. ORF    72    78    PC    74    84    SCTRW    74    85    SCTRW    74    85    ISTRW    74    85    SCTRW
  18249. ORL    74    87    ISTRW    75    90    SCTRW    75    91    SCTRW    75    93    SCTRW    75    88    SCTRW
  18250. PAH    65    85    PC    65    85    PC    65    94    PC    73    88    SCTRW    73    85    ISTRW
  18251. PAM    73    87    SUN    75    85    ISTRW    74    87    ISTRW    75    90    ISTRW    73    87    SCTRW
  18252. PDX    53    74    PC    54    74    PC    54    74    VCLDY    54    75    SCSW    54    74    SCSW
  18253. PFN    73    87    SUN    74    85    ISTRW    74    87    ISTRW    75    90    ISTRW    73    87    SCTRW
  18254. PHL    65    75    PC    73    82    TRW    73    84    SCTRW    73    85    ISTRW    73    84    SCTRW
  18255. PHX    76    100    SUN    82    104    PC    81    104    PC    81    104    PC    82    103    PC
  18256. PIH    48    86    SUN    46    92    PC    54    93    PC    55    93    PC    54    84    PC
  18257. PIR    64    85    PC    63    91    PC    60    85    PC    55    85    PC    62    86    ISTRW
  18258. PIT    61    75    SHW    65    84    ISTRW    65    83    ISTRW    64    85    SCTRW    66    79    AMSHW
  18259. PSP    81    107    SUN    75    104    SUN    76    105    SUN    81    104    SUN    74    107    PC
  18260. PWM    56    75    PC    63    77    TRW    63    75    SCTRW    65    83    ISTRW    65    75    SCTRW
  18261. RAP    63    84    PC    57    90    PC    55    85    PC    56    85    PC    63    93    ISTRW
  18262. RDU    73    83    SCTRW    69    84    SCTRW    73    85    SCTRW    74    90    ISTRW    74    92    SCTRW
  18263. RIC    73    77    R    73    84    SCTRW    73    84    SCTRW    74    86    ISTRW    74    85    SCTRW
  18264. RKS    54    86    PC    53    86    PC    51    86    ISTRW    54    89    ISTRW    54    84    ISTRW
  18265. RNO    53    93    SUN    52    90    SUN    51    89    SUN    53    87    PC    53    85    PC
  18266. ROA    64    76    R    66    81    ISTRW    66    82    SCTRW    67    86    ISTRW    67    83    SCTRW
  18267. SAC    58    98    SUN    54    92    SUN    56    92    SUN    56    91    PC    60    91    PC
  18268. SAN    72    85    SUN    68    88    ACLPS    68    80    ACLPS    68    82    ACLPS    68    81    PC
  18269. SAT    75    95    PC    75    96    PC    75    96    PC    75    100    PC    75    103    PC
  18270. SAV    73    85    PC    74    85    SCTRW    73    86    SCTRW    74    92    ISTRW    74    89    SCTRW
  18271. SEA    51    70    FSHW    53    71    VCLDY    53    71    SCSW    52    72    SCSW    52    72    SCSW
  18272. SFO    56    84    SUN    56    77    ACLPS    56    79    ACLPS    56    74    VCLDY    56    75    VCLDY
  18273. SGF    65    88    PC    65    86    PC    66    94    ISTRW    73    86    SCTRW    66    86    ISTRW
  18274. SHR    53    83    PC    51    84    PC    50    85    PC    56    89    ISTRW    58    86    ISTRW
  18275. SHV    72    94    PC    73    94    ISTRW    73    95    PC    75    95    ISTRW    75    95    ISTRW
  18276. SLC    59    88    SUN    62    92    PC    60    92    PC    61    92    PC    61    91    ISTRW
  18277. SSI    73    87    SUN    75    85    SCTRW    73    87    SCTRW    75    90    ISTRW    74    88    SCTRW
  18278. SSM    54    74    SUN    56    76    ISTRW    56    76    SCTRW    56    68    AMSHW    50    75    PC
  18279. STL    64    85    PC    65    85    PC    65    88    ISTRW    73    85    SCTRW    65    85    PC
  18280. SUX    65    85    PC    64    86    ISTRW    65    83    SCTRW    64    85    PC    62    85    PC
  18281. SYR    58    76    MCLDY    65    79    SCTRW    65    76    SCTRW    64    84    SCTRW    65    76    AMSHW
  18282. TOP    65    93    PC    65    90    ISTRW    71    94    ISTRW    68    86    PC    65    86    PC
  18283. TPH    57    96    SUN    63    95    SUN    64    98    SUN    64    96    SUN    65    94    PC
  18284. TRI    61    80    SCTRW    65    81    ISTRW    66    84    ISTRW    66    86    SCTRW    68    80    SCTRW
  18285. TUL    65    94    PC    65    94    PC    73    95    PC    74    93    ISTRW    68    93    ISTRW
  18286. UIL    45    68    MCLDY    54    66    SCSW    53    66    SCSW    54    66    SCSW    53    66    SCSW
  18287. VLD    74    86    SCTRW    75    85    ISTRW    74    93    SCTRW    74    94    ISTRW    75    93    SCTRW
  18288. IGRPO
  18289. |CARD
  18290. Monthsdata
  18291. RW    65    76    AM+BiO
  18292.     Day1_hidedata
  18293. UUAUUUUUAUAUAUUGAAUAUUAUOUUUUOAAUUUUAUAUUAUUAUUUOAUOUUOUOUUUOUOUAUKAUUUUOUOUAAUAV{{
  18294. SAUAUOUAGXAUUAUGGGAUGOAUUUOAUUAUAUAUUASUUSUAUUAUAUAUUUUOUUUAUUUUOUAUUUOUUUOAUUAv
  18295. @@UAGAAAA@AGAA@AA@AAAAAAAUAAAAAOXKAAA@A@AOAAAAAGAAAAUOAAUAAAGAU@OAAUAAAAAAAUA
  18296. (2272
  18297. 22777
  18298. 15:NWS\(
  18299. 76(7(:
  18300. rhlrnt`(
  18301. hZZZrvt
  18302. 22-nn
  18303. 32$(Y
  18304. #    zSd
  18305. (6ha{
  18306. ppu{p
  18307. {{{rrw
  18308. 63:<3:
  18309. #) &<><) )<P<851<P>JE>J<888888<>PPPPPffffff\ffP\\PPP<<888220088>E<>J<<8<EPNNNAAAKAAAAAAAKX
  18310. alltl
  18311. -0<04
  18312. 8"""-*8,
  18313. {{{p    3
  18314. P<<888<JP><>PPP>PP`hfP\P\PNP8###&#&&&&
  18315. #&&00" &&.08228<:8:ATNNNfP\ffhffhhhhhfhffP) 11
  18316. hl*8X
  18317. {ngh~^n
  18318. N88<8822888<<J<<<2<<8<EPP2##
  18319. #&)&000)&&&&&..018:::1 
  18320.  &088><J<88>J088880
  18321. P<<<;<002888><<E><EE<8<JJ2&"  #####
  18322. #"20&0282.0200002820:1 
  18323. ######&0& #&&## #
  18324. PE>88200008>JJJPPPJP<28><282&&&&&&"#####&002882<882282280#&.
  18325. P;000280022<JPJPPPPPJ88202222028800)&&&)0888888<><>JJ>>2& #
  18326. ###&&&& & 
  18327. <:999
  18328. 553&0
  18329. MP>>>J><JJPPPTPP\PPhPPPPJJ>><><<8>JJ>8;8<<<>>J<0&  ####"&0.02<<><.#&8<888)0).&###&&##"
  18330. fMPPPPMPPP\h\hf`hhh`ff`fPPPPJPP><>P>><><J>J>JJ0#
  18331. &.22<8<>><><><8<J<>000.&&&"&.&"#
  18332. hhhhPfPf`hhhhhhhfhhhhhhf\f\MffPPPPPPPJ>J>J>PPP)
  18333. 088>J>J>>JJJJ><>>J<;80&)02000&######&
  18334. rtttttn
  18335. fohohhhhhhhhh
  18336. hhhhhPP>&##
  18337. #&>>JJPPPPPPPPPPJ>JJJ;<>8J>J><;)&&&0002;
  18338. sttttr
  18339. ZTAIL
  18340.     Day2_hidedata
  18341. UUUUUUUeUUUXUXiUXXXUXUUUXUUXUXXUXXUXXUXXXXUXUUUUUUXUXiXiXUiUiUUXUUUXUUXUXUUUUUXUUXU
  18342. UUUU    
  18343. kiiXXXUUUUUUOOUUOUUUOUAUOUOAAUOASASUUUOAAUAUUOUAAAAAGUOAGAUAUOUAUAAUAUAAUUAAG[V{
  18344. kkiXXXUOUUUUAAUUUUUOUUUOUUUUASASOAU@UGAUUOAUOSUUUAOOAUOAAU@AAAUUAUAAUAAAG@v{{
  18345. tkiXUUUAUAAUAUUOAUUOOUUOUAUASAAUOOOAAAUAUUUOUUOAUAAAAAGAUAGA@UA@AAAUGASV{
  18346. kXKUUAA@UAOAA@AAAAGAA@AA@A@AA@@@AGA@AGAA@@AA@A@AA@A@@AAGA{
  18347. pTKAAAAAAAAA@AA@@AAA@AAAA@AAAAAAA@AA@AAAA@A@AAAA@AAAA@AA@AO
  18348. 72+$rpN
  18349. heeb5
  18350. a?2>6
  18351. pea+'25
  18352. ph++>6
  18353. ~ss\\-4!
  18354. uwph+?
  18355. ~ddM.8)
  18356. p[WW+
  18357. aWKK6
  18358. 88EJPJPPP\PfTKNNTKAAAAA@AAAAAAAAAA1) 
  18359. )1)$ 
  18360. 3+3>:
  18361. fhfhhhhh\\\hfh\`fhTAAAA))  
  18362. fffhhffhhhhfhhhfhhT:::1 
  18363.  # #&" &
  18364. NfP\ffhffhhhhhfhffP) 11
  18365. #  ###&&.
  18366. 08>JP\hfhP\hfPPP\`> 
  18367.   #&&& 
  18368.  &0.0&
  18369.  &088><J<88>J088880
  18370.     #&& 
  18371.  &).122.)1.22)
  18372. ######&0& #&&## #
  18373.  ###".&
  18374.  #  &&.&  #
  18375. 2   ).22<81.0.2<<J>.
  18376. #####&&##
  18377.  ##&.)&&.0 
  18378. &82288<8<<821..88<<>2 
  18379. 995<<<
  18380. :::9999
  18381. 3044?
  18382. <:999
  18383. )0220##&&&& #&###
  18384. ## ##
  18385. ###&&&##&&).0128>J>888>>>J<<PPPPPPPPPJJ>2& ## 
  18386. .#"8<888)0).&###&&##"
  18387. ###&#"####### ##&&##"&.08228<E>EE>JJJJPPJJNPPPJPJP<82&&#"&)
  18388. <<8<J<>000.&&&"&.&"#
  18389. "#"#"&&#&&&&#&&## &&&&&&0.8<<><>JPPJJ<JJPJPPPPJPJPJPJ<20.0&&&0
  18390. J><>>J<;80&)02000&######&000)0&&&&&&&"&0&&&)082<<JNJPPPPJ>JPJJPPJPPJJPPPJJ<80&&###&
  18391. J><<JPJE80088822)&#&&&&&00000&&0&0&&&&0&&)00;88JPPP\P\PPPJPJPPPPPJJPJPMPPP;8.&##&##
  18392. PJJ>JPPJ>2<><<88)&&&&0000;8820000.0).0.00028>EMPPPPhf`PPPJJPPPPJ>8>8<JPJJ>88)&##"&&
  18393. J>JPJ80;88>>>>>80000280;JJJJJJ8;8;<;8;8<<JPM\hhhhfhhh\PPPJJ>J882&.)0&0000)088000&00
  18394. sttttr
  18395. hqh~vkhq}vl
  18396. rn,X,
  18397. 6<:884:
  18398. P>>>JJJJ>>JMPPPPP>J`hhhf`h`\PPJPJPJJJJ>P\\PPPPJJPPJ<8>>JPPPJ>88;8>88228288;8;;>;820
  18399. _TAIL
  18400. PP;8.&##&##
  18401.     Day3_hidedata
  18402. |d@{6.
  18403. bQS!"
  18404. |Uo66
  18405. UUUXUXUU
  18406. UOUASAUUUUUASUUOAUUAAUUUASAASAUUUUUUAAUUAUAGAUUUUUUSAAUASUUGUAUGAGAAGASAUGU@OAAGAGASGAGSAAAGU@UAUGAS@GGGSAUUUXkk
  18407. UUUUUAUAUUXUUUUUUU@UAGAGSUASAAGUSUAAUSAUSAUGSASAASUOAGUGUUUAUGASGAUAUSAUAUUAGU@OASGAUGAGUUAGAGGSAGGASA@U@UOUUUXk
  18408. UUUUOUUU
  18409. UUXXXUUOUUOAAUUUOUU@AGUOUAAGAUUOGASAAUGOGAGAGGAUGASAUUA@OU@UGOUSASUAGAUOOAGAGAG@@U@AUAG@GGA@AU@G@AGA@G@GAGAAUUUX
  18410. iXXXXXUXXUXUUUUAUOUUAUUUAASAGUOAGSASAGAAUAAGAAUGAGAAGASAGAAGAUAAGUAAGSAAAG@AG@AAUAU@AGAAG@AG@A@@AG@@@@@AGASGUAUX
  18411. iiXiXXiXXXXXUXOUUUUAUAGASAUUAAAAAASAGOAAAAGO@GAGAGOGUSAGAUAAAUGAUAGGA@AGA@G@AGAGAG@GGAGA@AG@A@GAU@G@@@@G@@AAAUUU
  18412. kkkkkkiiXiXXXXUXUUOUAUAUAUAAAUASG@AGAUAUAGAGAAAAGOAAGAAASAGGGAAASAAAAGAAG@@GGSAG@AG@AGAG@A@G@GA@A@@@@G@@@GAG@UOU
  18413. tkktkkiXXXXXUUOUAUAUAAAGOAUAUGOU@AAUAAAGAS@AGGGAGASAGUAAGAGAAUG@AG@AAGAAAGAGU@A@AG@AGA@A@@AG@ASA@@@@@G@GAUU
  18414. tkkkiiXXXUAGOAUAUAG@AGAA@AAAAAAGUAS@@AAAA@AGAGAGA@UGAAAGAGAGA@AAG@G@GAG@UA@@AG@@@AA@A@G@AGOA@@AG@@AG@AU
  18415. #FFrW-
  18416. ^PDt*1/
  18417. YXYX,PPFtra
  18418. =  PyfR1
  18419. / PDiT1/
  18420. 3/ PciT1
  18421. 6/  fkfA;
  18422. 63/ fw[G1
  18423. a.>.+>>
  18424. qdeea>:
  18425. de>=.
  18426. uqa+>>>:
  18427. a>222
  18428. 63::::
  18429. p >26
  18430. }pXXAAAA@A4@@@A@AA4 
  18431. 44A4A4A@6@A@A@@6@4 
  18432. pkTKAAA@A@A@AA@A44 
  18433.   $44444A@AA@4@A@44 
  18434. pkXKAAA@AA@A@AA1$ 
  18435.      $44AAA@A6A4AA1$
  18436. 66/  QDvQW
  18437.  WWWWWT2
  18438. 66:?>3>3
  18439.     >32?"W'*
  18440. >:.+25
  18441.   $&5)$08 
  18442.   &0.).& 
  18443. |bF9(
  18444.   $&$& 
  18445. @zZ&)8
  18446. 144        
  18447. 9::::
  18448.   #&..111.)$&# #         &&)).....&)&&
  18449.      ##    &&)..2211.).$$  "$&&&&&&.)..101.....)
  18450.      
  18451.     &&.)...1...1118<<<<:882....)&.)..0.1.212111881.11211
  18452. # &&)0..122822228<<<<<<<80.........)...2882888821122812
  18453. 288<<<<821..88<<>2  
  18454.  #" #"# &).).8<<>JPPN<EE><>;82<<E<<<E<<<<><<<<8250888<<81288<828
  18455. 8>E<<<J<<<88<<<<882))&##
  18456. # #  #&&&).8<<<>NPNJJJJ<<<8288<<JJPJNJ<<<<J<<88888<<88.0.0.0282
  18457. ><><<>J<E<<<<JPJ<J<80##
  18458. ##&&#
  18459. # # # ##&&)).2888<<EEJPPJ<<882888<EPJJEE<E<E<><<<8<<<<><8&&&&)&.1.
  18460. <<><>E>JJJNPPPPPJPJ8& 
  18461.  #)&#
  18462. ##"# #"# # #####"&..0.8288<<><<<EJ<888888<JNEPE><<<<<JJ<><<<8<<880# #&&&&0)
  18463. >>>J<<PPPPPPPPPJJ>2& ## #&0)#
  18464.  #&&# "&)0"#" ###" #""&&)001221888<><E><<<<8<<<>ENPPEPNEE>E<EE<E<<<8<<82)$#"#&"&)&
  18465. JJJPPJJNPPPJPJP<82&&#"&))&&&###&&##&&&)0"  &#"  ##&&&..0.00028<<<828<88<<<<EEEJPPPPPPPP<<P<J<<<<888880.&&&&&)&&&
  18466. PJPPPPJJPJPMPPP;8.&##&##000&&#&"&&).02200&&&&&&&&&000010120288<888888><P><EJNP\PPPPP\PPNPPPPPE><<<<>2)&)))..)&&&
  18467. PPPPJ>8>8<JPJJ>88)&##"&&0)000)&&0..0228.&&&&&&0&0)0.22010188<8J<<<<8<EJPPJE>PPP\fPPfPP\T\PPPPPN<<<J><82.&))&&&&)
  18468. JMJ;80&08028;20082&0&&&0000000000.02888.&&)0)0).00.2822888>>JJPJJ<<<>>PPNPJNPPPPPPfPP\P`PPPPPPN<NP><<<<8.1)&)&&)
  18469. >J882&.)0&0000)088000&002000002082282<;2.00.0..&00222<<8<<<JPPPPPP><J<EPPEEJPPPPP\PPPT\f\PfPPNPPPNPNPE<<28)).).0
  18470. J<82822000.00008822200000000.008888888<0002000.008288<<J>PPPPP\PPPJ>PNPPPPJPPPPP\PP\T\h\PP\TfPNPPPPPPJP>E8..212<
  18471. P>;;88<8200202882888800000020288;;888>8.0.00000028<;>JPPPPPP\P\PPPNPPPPPPPPPNPP\PPPP\f\f\fffff\fPfPfPPPE<<<<8<<<
  18472. bTAIL
  18473.     Copyrightdata
  18474. }+ &c
  18475. +m;iM
  18476. i+252
  18477. [32N*
  18478. i2Op+!b
  18479. 331113,131331
  18480. ,1111
  18481. (+BiO
  18482. Day1_hilitedata
  18483. 5!!6U
  18484. Albuquerquedata
  18485. 62/40TAIL
  18486. Day2_hilitedata
  18487. 5!!6U
  18488. Day3_hilitedata
  18489. 5!!6U
  18490. Day1SCRP
  18491. on mouseUp
  18492.   global gWCwhichday
  18493.   global gWCcurrCities
  18494.   global gNAVcdev
  18495.   global gNAVEpcotPath
  18496.   global gWCpath
  18497.   global gWCvoicePath
  18498.   global gWCacceptMouseClicks
  18499.   global gWChilitedReg
  18500.   global gNAVEpcotPath
  18501.   global gWCpath
  18502.   global gWCvoicePath
  18503.   global gWCmainMusic
  18504.   global gWCdate
  18505.   send mouseLeave to cd btn (the short name of me)
  18506.   if gWCacceptMouseClicks is not "false" then
  18507.     mouseHasBeenClicked
  18508.     --ring cd alarm "alarmSelect" of cd "National" at 2100
  18509.     start cd timer "alarmSelect" of cd "National" expire in 2100 ticks
  18510.     --play file (gNAVEpcotPath & gWCpath & gWCvoicePath & gWCtriviaVoice) nowait
  18511.     --    set the soundFile of cd snd "main" to 
  18512. --         (gNAVEpcotPath & gWCpath & gWCvoicePath & gWCtriviaVoice)
  18513.     --play cd snd "main"
  18514.     send mouseDown to cd btn (the short name of me)
  18515.     send mouseLeave to cd btn (the short name of me)
  18516.     send mouseDown to cd btn (the short name of me)
  18517.     send mouseLeave to cd btn (the short name of me)
  18518.     lock screen
  18519.     hide grp "Cities"
  18520.     show cd bmp "Day1_hide"
  18521.     hide cd btn "Day1"
  18522.     hide cd bmp "Day2_hide"
  18523.     show cd btn "Day2"
  18524.     hide cd bmp "Day3_hide"
  18525.     show cd btn "Day3"
  18526.     if gNAVcdev is "REMOTE" then
  18527.       send mouseDown to cd btn "Day2"
  18528.       put "Day2" into gWChilitedReg
  18529.     end if
  18530.     unlock screen
  18531.     put "today" into gWCwhichday
  18532.     put gWCdate into cd fld "DayOfWeek"
  18533.     putinNewData (the number of this card), gWCcurrCities, 0
  18534.     show grp "Cities"
  18535.   end if
  18536. end mouseUp
  18537. -------------------------
  18538. on mouseDown
  18539.   cdbuttondown (the short name of me)
  18540. end mouseDown
  18541. -------------------------
  18542. on mouseLeave
  18543.   cdbuttonLeave (the short name of me)
  18544. end mouseLeave
  18545. downregion
  18546. leftbutton
  18547. leftregion
  18548. rightbutton
  18549. rightregion
  18550. upregion
  18551. WestTAIL
  18552.  send mo+BUT
  18553. KINFO
  18554. Day2SCRP
  18555. on mouseUp
  18556.   global gWCwhichday
  18557.   global gWCcurrCities
  18558.   global gNAVcdev
  18559.   global gWCtomorrowdate
  18560.   global gWCvoicePath
  18561.   global gWCacceptMouseClicks
  18562.   global gWChilitedReg
  18563.   global gNAVEpcotPath
  18564.   global gWCpath
  18565.   global gWCvoicePath
  18566.   global gWCmainMusic
  18567.   global gWCDate
  18568.   send mouseLeave to cd btn (the short name of me)
  18569.   if gWCacceptMouseClicks is not "false" then
  18570.     mouseHasBeenClicked
  18571.     --ring cd alarm "alarmSelect" of cd "National" at 2100
  18572.     start cd timer "alarmSelect" of cd "National" expire in 2100 ticks
  18573.     --play file (gNAVEpcotPath & gWCpath & gWCvoicePath & gWCtriviaVoice) nowait
  18574.     --    set the soundFile of cd snd "main" to 
  18575. --         (gNAVEpcotPath & gWCpath & gWCvoicePath & gWCtriviaVoice)
  18576.     --if the isplaying of cd snd "main" is false then play cd snd "main"
  18577.     send mouseDown to cd btn (the short name of me)
  18578.     send mouseLeave to cd btn (the short name of me)
  18579.     send mouseDown to cd btn (the short name of me)
  18580.     send mouseLeave to cd btn (the short name of me)
  18581.     lock screen
  18582.     hide grp "Cities"
  18583.     hide cd bmp "Day1_hide"
  18584.     show cd btn "Day1"
  18585.     show cd bmp "Day2_hide"
  18586.     hide cd btn "Day2"
  18587.     hide cd bmp "Day3_hide"
  18588.     show cd btn "Day3"
  18589.     if gNAVcdev is "REMOTE" then
  18590.       send mouseDown to cd btn "Day1"
  18591.       put "Day1" into gWChilitedReg
  18592.     end if
  18593.     unlock screen
  18594.     put "tomorrow" into gWCwhichday
  18595.     put gWCtomorrowdate into cd fld "DayOfWeek"
  18596.     putinNewData (the number of this card), gWCcurrCities, 3
  18597.     show grp "Cities"
  18598.   end if
  18599. end mouseUp
  18600. -------------------------
  18601. on mouseDown
  18602.   cdbuttondown (the short name of me)
  18603. end mouseDown
  18604. -------------------------
  18605. on mouseLeave
  18606.   cdbuttonLeave (the short name of me)
  18607. end mouseLeave
  18608. downregion
  18609. leftbutton
  18610. leftregion
  18611. rightbutton
  18612. rightregion
  18613. upregion
  18614. WestTAIL
  18615.  +BUT
  18616. LINFO
  18617. Day3SCRP
  18618. on mouseUp
  18619.   global gWCwhichday
  18620.   global gWCcurrCities
  18621.   global gNAVcdev
  18622.   global gWC1dayafterdate
  18623.   global gWCvoicePath
  18624.   global gWCacceptMouseClicks
  18625.   global gWChilitedReg
  18626.   global gNAVEpcotPath
  18627.   global gWCpath
  18628.   global gWCvoicePath
  18629.   global gWCmainMusic
  18630.   send mouseLeave to cd btn (the short name of me)
  18631.   if gWCacceptMouseClicks is not "false" then
  18632.     mouseHasBeenClicked
  18633.     --ring cd alarm "alarmSelect" of cd "National" at 2100
  18634.     start cd timer "alarmSelect" of cd "National" expire in 2100 ticks
  18635.     --play file (gNAVEpcotPath & gWCpath & gWCvoicePath & gWCtriviaVoice) nowait
  18636.     --set the soundFile of cd snd "main" to gPathAudio&gWCtriviaVoice
  18637.     --if the isplaying of cd snd "main" is false then play cd snd "main"
  18638.     send mouseDown to cd btn (the short name of me)
  18639.     send mouseLeave to cd btn (the short name of me)
  18640.     send mouseDown to cd btn (the short name of me)
  18641.     send mouseLeave to cd btn (the short name of me)
  18642.     lock screen
  18643.     hide grp "Cities"
  18644.     hide cd bmp "Day1_hide"
  18645.     show cd btn "Day1"
  18646.     hide cd bmp "Day2_hide"
  18647.     show cd btn "Day2"
  18648.     show cd bmp "Day3_hide"
  18649.     hide cd btn "Day3"
  18650.     if gNAVcdev is "REMOTE" then
  18651.       send mouseDown to cd btn "Day1"
  18652.       put "Day1" into gWChilitedReg
  18653.     end if
  18654.     unlock screen
  18655.     put "1dayafter" into gWCwhichday
  18656.     put gWC1dayafterdate into cd fld "DayOfWeek"
  18657.     putinNewData (the number of this card), gWCcurrCities, 6
  18658.     show grp "Cities"
  18659.   end if
  18660. end mouseUp
  18661. -------------------------
  18662. on mouseDown
  18663.   cdbuttondown (the short name of me)
  18664. end mouseDown
  18665. -------------------------
  18666. on mouseLeave
  18667.   cdbuttonLeave (the short name of me)
  18668. end mouseLeave
  18669. downregion
  18670. leftbutton
  18671. leftregion
  18672. rightbutton
  18673. Trivia
  18674. rightregion
  18675. upregion
  18676. SouthTAIL
  18677. d bt+BiO
  18678. Trivia_hilitedata
  18679. TriviaSCRP
  18680. on mouseUp
  18681.   global gWChilitedReg
  18682.   global gNAVcdev
  18683.   global gWCmonth
  18684.   --  global gNAVEpcotPath
  18685.   global gWCpath
  18686.   global gWCtriviaVoice
  18687.   global gWCvoicePath
  18688.   global gWCacceptMouseClicks
  18689.   global gpathAudio
  18690.   if gWCacceptMouseClicks is not "false" then
  18691.     mouseHasBeenClicked
  18692.     send mouseLeave to cd btn "Trivia"
  18693.     send mouseDown to cd btn "Trivia"
  18694.     send mouseLeave to cd btn "Trivia"
  18695.     send mouseDown to cd btn "Trivia"
  18696.     send mouseLeave to cd btn "Trivia"
  18697.     --ring cd alarm "alarmSelect" of cd "National" at 1800
  18698.     start cd timer "alarmGoBack" of cd "National" expire in 1800 ticks
  18699.     --play file (gNAVEpcotPath & gWCpath & gWCvoicePath & gWCtriviaVoice) nowait
  18700.     set the soundFile of cd snd "main" to 
  18701.          (gPathAudio & gWCtriviaVoice)
  18702.     play cd snd "main"
  18703.     lock screen
  18704.     show cd bmp gWCmonth
  18705.     show cd btn "Continue"
  18706.     unlock screen
  18707.     if gNAVcdev is "REMOTE" then
  18708.       send mouseLeave to cd btn "Trivia"
  18709.       send mouseDown to cd btn "Continue"
  18710.     end if
  18711.     put "Continue" into gWChilitedReg
  18712.     disable cd btn "Trivia"
  18713.   end if
  18714. end mouseUp
  18715. -------------------------
  18716. on mouseDown
  18717.   cdbuttonDown (the short name of me)
  18718. end mouseDown
  18719. -------------------------
  18720. on mouseLeave
  18721.   cdbuttonLeave (the short name of me)
  18722. end mouseLeave
  18723. downregion
  18724. leftbutton
  18725. leftregion
  18726. rightbutton    StartOver
  18727. rightregion
  18728. upregion    SouthEastTAIL
  18729.  cd btn "Co+BiO
  18730. StartOver_hilitedata
  18731.     StartOverSCRP
  18732. on mouseUp
  18733.   global gWCpath
  18734.   global gWCnavApp
  18735.   global gNAVStackPath
  18736.   global gWCacceptMouseClicks
  18737.   global gNAVcdev
  18738.   global gWChilitedReg
  18739.   global gWCreg_or_btn
  18740.   if gWCacceptMouseClicks is not "false" then
  18741.     mouseHasBeenClicked
  18742.     if gNAVcdev is "REMOTE" then
  18743.       if gWCreg_or_btn is "region" then
  18744.         send mouseLeave to cd bmp gWChilitedReg
  18745.       else
  18746.         send mouseLeave to cd btn gWChilitedReg
  18747.       end if
  18748.     end if
  18749.     send mouseLeave to cd btn "StartOver"
  18750.     send mouseDown to cd btn "StartOver"
  18751.     send mouseLeave to cd btn "StartOver"
  18752.     send mouseDown to cd btn "StartOver"
  18753.     send mouseLeave to cd btn "StartOver"
  18754.     --go gNAVStackPath & gWCnavApp
  18755.     global gpomopath
  18756.     go cd "black"
  18757.     lock screen
  18758.     go gpomopath    
  18759.   end if
  18760. end mouseUp
  18761. -------------------------
  18762. on mouseDown
  18763.   cdbuttonDown (the short name of me)
  18764. end mouseDown
  18765. -------------------------
  18766. on mouseLeave
  18767.   cdbuttonLeave (the short name of me)
  18768. end mouseLeave
  18769. downregion
  18770. leftbutton
  18771. Trivia
  18772. leftregion
  18773. rightbutton
  18774. rightregion
  18775. upregion    SouthEastTAIL
  18776. StartO+BUT
  18777. Portland_coverSCRP
  18778. on mouseDown
  18779.   send MouseDown to cd bmp "NorthWest"
  18780. end mouseDown
  18781. on mouseUp
  18782.   send mouseUp to cd bmp "NorthWest"
  18783. end mouseUp
  18784. omopat+BUT
  18785. SanFrancisco_coverSCRP
  18786. on mouseUp
  18787.   send mouseUp to cd bmp "West"
  18788. end mouseUp
  18789.  cdbuttonL+BUT
  18790. LosAngeles_coverSCRP
  18791. on mouseUp
  18792.   send mouseUp to cd bmp "West"
  18793. end mouseUp
  18794. Albuquerque_coverSCRP
  18795. on mouseUp
  18796.   send mouseUp to cd bmp "South"
  18797. end mouseUp
  18798. useUp to c+BUT
  18799. Denver_coverSCRP
  18800. on mouseUp
  18801.   send mouseUp to cd bmp "Central"
  18802. end mouseUp
  18803. d mouseUp to +BUT
  18804. Bismarck_coverSCRP
  18805. on mouseUp
  18806.   send mouseUp to cd bmp "North"
  18807. end mouseUp
  18808. mouseUp to cd+BUT
  18809. NewOrleans_coverSCRP
  18810. on mouseUp
  18811.   send mouseUp to cd bmp "South"
  18812. end mouseUp
  18813. on mouseDown
  18814.   send MouseDown to cd bmp "South"
  18815. end mouseDown
  18816. Atlanta_coverSCRP
  18817. on mouseUp
  18818.   send mouseUp to cd bmp "SouthEast"
  18819. end mouseUp
  18820. on mouseDown
  18821.   send mouseDown to cd bmp SouthEast
  18822. end mouseDown
  18823. smarck_co+BUT
  18824. Chicago_coverSCRP
  18825. on mouseUp
  18826.   send mouseUp to cd bmp "GreatLakes"
  18827. end mouseUp
  18828. wOrleans_+BUT
  18829. Orlando_coverSCRP
  18830. on mouseUp
  18831.   send mouseUp to cd bmp "SouthEast"
  18832. end mouseUp
  18833. WashingtonDC_coverSCRP
  18834. on mouseUp
  18835.   send mouseUp to cd bmp "MidAtlantic"
  18836. end mouseUp
  18837. d b+BUT
  18838. Boston_coverSCRP
  18839. on mouseUp
  18840.   send mouseUp to cd bmp "NorthEast"
  18841. end mouseUp
  18842. Up to cd bm+TXT
  18843. keypressdata
  18844. qssssssssssssssssssssssssssssssssssssssssqqqsssqqqqTAIL
  18845. en+BiO
  18846. waitdata
  18847. """0"0"
  18848. "00"""0
  18849. s{ss{
  18850. ""0"""
  18851. """""0
  18852. {{{s{{
  18853. {{ss{{s{
  18854. """"""
  18855. {{s{{{
  18856. 00"""0
  18857. """0""""
  18858. """0"
  18859. "0"0""
  18860. """0"""
  18861. &&&&&&
  18862. 7&&7M
  18863. e&&7&&7&e&&7&
  18864. 7uW&7
  18865. {ss{{s
  18866.     `777
  18867. S&&&u
  18868. 7&&*((
  18869. XXKB~
  18870. LEBBj
  18871. 9.h77?i9&
  18872. q&&&i(7
  18873. &&&&((7
  18874. &&&&9(7
  18875. 7&&&(((9
  18876. 777i9/
  18877. LXLVV{
  18878. LLLBB{    
  18879. L?LiV/
  18880. 777i-/
  18881. &&&&(9
  18882. 7&i9((4
  18883. &&7&((
  18884. 0MVVbMV
  18885. WSSSS
  18886. ((: &
  18887. >?>>7
  18888. S&&&:
  18889.                     
  18890. )c$iG
  18891. {%T"%%TY^{
  18892. k]]kk]]k
  18893.     {            
  18894. jTk{j]k{
  18895. {k]{{k]{
  18896.                             
  18897. /((((((:?((((((:
  18898. {{s{{s
  18899. {{s{{{
  18900. {{ss{{{
  18901. {s{{s
  18902. ?TAIL
  18903. Help_hilitedata
  18904. v``Q'""
  18905. ^$z$^^$
  18906. vv``''""
  18907. {$%%$$%
  18908. v``Q!"
  18909. %%$%%
  18910. $%$%%
  18911. vv``''11
  18912. v```'11$
  18913. %%$%%%$%
  18914. vvvvvvvv
  18915. evvvvvv`
  18916. --2--
  18917. ???==
  18918. ??===??
  18919. =?=??
  18920. cedeedeek
  18921. c\\N-
  18922. vdeebe
  18923. ll~l~~LC
  18924. 2/s{*
  18925. ==FH*
  18926. dedekdeddd
  18927. III-III-I-I-I
  18928. ddkdddddddd
  18929. Ydd~Y
  18930. vvvededcedeedd
  18931. ======d
  18932. d~Y~d
  18933. vdece
  18934. =5?>?
  18935. Z?>fY
  18936. fZfd|Z|||
  18937. edddddjdd
  18938. vvkeebd
  18939. vvkeece
  18940. eeeee
  18941. edjdeek
  18942. ceecekee
  18943. ===d=d=
  18944. =d=~Y'
  18945. ekeekeeek
  18946. =Yd=~YYi
  18947. djdeek
  18948. vceedb
  18949. ddeee
  18950. eecee
  18951. jdbddd
  18952. eeeke
  18953. dbddceebd
  18954. `%<+@D\??
  18955. keecdj
  18956. djdceej
  18957. kecek
  18958. eceke
  18959. |    ;;yr
  18960. !cbc^+3
  18961. <vDb3O?qD@%
  18962. kecebdbek
  18963. ecdke
  18964. kekddcdke
  18965. 77777
  18966. 8HFii
  18967. ccdke
  18968. bcejke
  18969. DaaP-]
  18970. cdjke
  18971. dkkdcb
  18972. ]I%%O]
  18973. W}gm0i
  18974. }vxxx
  18975. CC}g$$
  18976. HelpSCRP
  18977. on mouseUp
  18978.   global gWChilitedReg
  18979.   global gNAVcdev
  18980.   --  global gNAVEpcotPath
  18981.   global gWCpath
  18982.   global gWCtriviaVoice
  18983.   global gWCvoicePath
  18984.   global gWCacceptMouseClicks
  18985.   global gpathAudio
  18986.   if gWCacceptMouseClicks is not "false" then
  18987.     mouseHasBeenClicked
  18988.     send mouseLeave to cd btn (the short name of me)
  18989.     send mouseDown to cd btn (the short name of me)
  18990.     send mouseLeave to cd btn (the short name of me)
  18991.     send mouseDown to cd btn (the short name of me)
  18992.     send mouseLeave to cd btn (the short name of me)
  18993.     --ring cd alarm "alarmGoBack" of cd "National" at 1800
  18994.     start cd timer "alarmGoBack" of cd "National" expire in 1800 ticks
  18995.     --play file (gNAVEpcotPath & gWCpath & gWCvoicePath & gWCtriviaVoice) nowait
  18996.     set the soundFile of cd snd "main" to 
  18997.          (gPathAudio & gWCtriviaVoice)
  18998.     set the bufferSize of cd snd "main" to 180
  18999.     set the playVolume of cd snd "main" to 100
  19000.     play cd snd "main"
  19001.     lock screen
  19002.     if gNAVcdev is "REMOTE" then
  19003.       show cd bmp "Help_Remote"
  19004.       send mouseLeave to cd btn (the short name of me)
  19005.       send mouseDown to cd btn "Help_BackToMap"
  19006.     else
  19007.       show cd bmp "Help_Touch"
  19008.     end if
  19009.     show cd btn "Help_BackToMap
  19010.     unlock screen
  19011.     put "Help_BackToMap" into gWChilitedReg
  19012.     disableNavBtn
  19013.   end if
  19014. end mouseUp
  19015. -------------------------
  19016. on mouseDown
  19017.   cdbuttonDown (the short name of me)
  19018. end mouseDown
  19019. -------------------------
  19020. on mouseLeave
  19021.   cdbuttonLeave (the short name of me)
  19022. end mouseLeave
  19023. downregion    NorthEast
  19024. leftbutton
  19025. leftregion
  19026. rightbutton
  19027. rightregion
  19028. upregion
  19029. ave to cd+BiO
  19030. Help_Touchdata
  19031. RuA{    
  19032. D27Rc
  19033. RuAg^
  19034.  tgAV
  19035.     5577
  19036. Pq/=76
  19037. co0?S
  19038.     2557
  19039.     2557
  19040. 7(((    (((>
  19041. ((((((((
  19042. &(((>
  19043. 3(((3
  19044.     5567
  19045. {At,R
  19046. 6Ruto
  19047. =//=?
  19048. {%9bB
  19049. A21&c
  19050. t>k31
  19051. b21&o
  19052. co0?S
  19053. ]    &C9
  19054. 6666M
  19055. 666666
  19056. {{{t[wwK
  19057. ((((((((
  19058.         2567
  19059. 77777
  19060. 77777
  19061. ((-J}}i
  19062. }}U<9(
  19063. ((<J}}
  19064. j}}l?((
  19065. J}}}6
  19066. 9(<[}}Q
  19067. }l?((
  19068. J}}}}|||6
  19069. ((>lUUUU}}k9
  19070. i}EUUUUD<((
  19071. P~K}-
  19072. ((<[}}i
  19073. k}}J>((
  19074. G9~(~9G
  19075. s\HK8!567
  19076. <=<=&
  19077. SSSSSS
  19078. 28-5E
  19079. OG2Kuy4
  19080. J!''!
  19081. 6K6c6
  19082. GFSSSSSSSSSSSSSS
  19083. 4"9>II}Y
  19084. }M{%Y.
  19085. _IIQ#4
  19086. ^``uuuuuuuuuuuuuu
  19087. 4)i>^>
  19088. rcYe    MP
  19089. SP(SSQc
  19090. 1'4p4
  19091. x(g7rg6w?8
  19092.         256
  19093. &q:(((:6,75*
  19094. 9&<5od
  19095. ?>?>>?>?>>?>?>?;
  19096. TfRNuuWrftJnsk|hh~srXu
  19097. Ri.i-
  19098. o(~XZ~XZ~XZ~XZ
  19099. $LN~ZX~ZX~ZX(~
  19100.         ?277
  19101. 9(<l}}Q9
  19102. 9(}cD
  19103. kE}J>((
  19104.         2267
  19105. CBCBCCC@@@@@@CCCC@@C@@@@@@@@@@C@C
  19106. ((>l}}
  19107. 8'(GiAy
  19108. 9j}}l?9(
  19109. vm~(&
  19110. ((>J}}
  19111. 8i}}U<9(
  19112. ((<}}}i
  19113. }l?((
  19114. ((.J}
  19115. }}J>((
  19116. ((>U}}k
  19117. mmmmmlmmlml2l5l2555
  19118. mmmmlmlml2l5l25555
  19119. mmmmmlmlml2l2l25555
  19120. mmmmmml|mlmlml2l2l#l555555555$55555$55$555555$5555555$5555
  19121. Y=?45
  19122. =445    
  19123. ^Y_YYY_Y
  19124. =?44    
  19125. =445    
  19126. XYXYY
  19127. YXYYYY
  19128. XYXYXYXXYXY
  19129. Y^^YXY^^
  19130. Y^^^^
  19131. ?5677
  19132. YXXXY
  19133. ?5567
  19134. HHIHH
  19135. SSSSSSSSSSSSSSSS
  19136. ^uuuuuuuuuuuuuuuu
  19137. eII---
  19138. edddde
  19139. ?=^^==d
  19140. =d=dd
  19141. =:^XY
  19142. >?>?>?>?>?>?>??
  19143. Y^YXX
  19144. 4RSRg
  19145. 6RSXe
  19146.         2577
  19147.         2577
  19148. _Y^^^
  19149. 6.m]X
  19150. XYXY_
  19151. _YXXY^^^^
  19152. 7662            
  19153. 7652    
  19154. 56666665
  19155. *+**?
  19156. }JUUUUUUUUUUUUUUUUUJUJJJJJJJJ
  19157. XXXXN
  19158. GGXNNQNXNXXXXX
  19159. XXXXX
  19160. X6XnXN
  19161. XXXXX
  19162. XXnXX
  19163. XXXnX
  19164. SSSSSSSSSSSSSSSS
  19165. Kuuuuuuuuuuuuuuuu
  19166. *+*+:(
  19167. UJUJU
  19168. QXQfx)(>(
  19169. >QQX\tky&33
  19170. >>346    >??>?>>
  19171. >?>?>?>?>>?>?>?;
  19172. GNQX-;:,
  19173.     ?257
  19174. GQGN-:,:
  19175.         2577
  19176. JJJGXNXQ
  19177. Gy6Ny
  19178. QXGQ)>,:B
  19179.         2577R'&x`'&x3
  19180. yu'7x3
  19181. F&&"u&&33
  19182. XNfnXXfN
  19183. XNNXn
  19184. XGGGG
  19185. XXXXXXX
  19186. XXXXXXXXXXXX
  19187. =<%jjt,t,t,t,vtvtvtvt,tt,t,t,t,t,t,v,t,,t,,v,.:;
  19188. >=)??<
  19189. )>mn+1lv
  19190. 77>(/
  19191. /(9>>(
  19192. (>>(9&?x.'
  19193. ??((?
  19194. ?((44((:%((:
  19195. 3(:/3)
  19196. >((7>
  19197. >&((/    ?x.'
  19198. 0??-(
  19199. >9:    .(
  19200. >(9>>((>
  19201. A7>((
  19202. 9(((((((
  19203. &&7&&7~
  19204. &&<=<&<=<&
  19205. <&<=<&
  19206. <&<=<&
  19207. &&97&&
  19208. Y7d^>v
  19209. ~~o~~~o
  19210. ~&~7~~
  19211. ~~o~X~X
  19212. 99999
  19213. 99&9&&
  19214. &X&~o
  19215. &BKg|>&
  19216. X&&&~X
  19217. ><=<7
  19218. }JlZ7Bh@|
  19219. ~&7~&
  19220. &X&&~~XZ
  19221. <=<7666
  19222. io&&&X
  19223. &999&&
  19224. 7dA$|
  19225. d9&XX
  19226. f7B7_
  19227. f,N&'
  19228. >3477
  19229. o&&7&
  19230. &=&<5
  19231. <=&<<
  19232. ~o~&p
  19233. SSSSSSSSWSSSSSSS
  19234. Wuuuuuuuu`uuuuuuu
  19235. ~o~&X
  19236. )o&&o~
  19237. `&&\7
  19238. Xg||$=
  19239.         2577
  19240. &9&9&&&~
  19241. >?>?>?>?>>?>?>?>k&O
  19242. >2<=<
  19243. &7&&&&
  19244. ~o|AZ
  19245. &=&&<=
  19246. R3<((
  19247. >%<((%
  19248. 3(((3((%<((%
  19249. (((3(
  19250. (((    (
  19251. (3(()
  19252. =((?>((>?((
  19253. (>?((
  19254. (((((
  19255. ((977(.
  19256. ~&&&X
  19257. 'o~~'
  19258. =<<44
  19259.         ?277
  19260. *+*+:(
  19261. }5}lKmHX
  19262. X7~Xo~X~
  19263. &=<&=<&<=
  19264. ?>>>3477
  19265.         2267
  19266. ((((((((
  19267. 7652        
  19268. 988^^
  19269. ^^9^x^
  19270. =>            
  19271. =''='=='==
  19272. dGY'=d]
  19273. `d='=
  19274. ~]d''=~
  19275. ]='='
  19276. ??<267
  19277. B==''
  19278. e0$>=
  19279. SSSSSSSSSSSSSSSS
  19280. vdY^'8
  19281. Wuuuuuuuuuuuuuuuu
  19282. `&&\7
  19283. ^^Yn0
  19284.     c:9^^Y    
  19285. ^$2~Y?
  19286. n34of`^|0Y^
  19287. "Z:n 
  19288. [8&_~0}^^'_|["9_
  19289. _9_9^[|_
  19290. fo`_^
  19291. >?>?>?>?>>?>?>?>k&O
  19292. 8_9X^'^g^^g
  19293. _9_'^8X^
  19294. ^8_&_
  19295. ^8_9_8^
  19296. _9_8_
  19297. 8_8^9
  19298. 8_9_8^~=
  19299. ^8_'^
  19300. `X`X`X~X `X]
  19301. `e` Y
  19302. ]X]X`:
  19303. Y`X]X`:
  19304. 7R&&&
  19305. [Za^S
  19306. kSRSkQkQkQkRRk
  19307.     2257
  19308. S7&x`'&x"
  19309. 7&33&&33
  19310. ce`;;#
  19311. &&((&&((
  19312. W&&>W&
  19313. u&&&S
  19314. &&((&&((
  19315. (&&((
  19316. >&&(7
  19317. &&((&`
  19318. {|kmFkp
  19319. &&(9&&((
  19320. (&&9(
  19321. (&7((
  19322. &&((&u
  19323. <9&&<(
  19324. {g(:Be
  19325. :    
  19326. 3(((    
  19327. ((:74<((
  19328. ((((9
  19329.     (9(3
  19330. ((((((
  19331. ?(((?>(()
  19332. ((    (((>
  19333.     (((3
  19334. 3(((3((%<((%
  19335. &b(?1(()
  19336. (9(34-((
  19337. [RAR[R[Y[[A[NHAAARARAR[R[R[Y[[R^RA[[R[A[RAA[AA[[AA[[AAA[[A[YAA[A[^[[[^RA^A[[[A[AAA[[A[A[A[[A
  19338.   {rR[        
  19339. [Az{  
  19340. 6H~~~
  19341. =_qkEV
  19342. Y^`z! 
  19343. p785r
  19344. 5?isll
  19345. ^Rzx!!
  19346.   KKkk
  19347. /svjy
  19348. Y[NL!!67
  19349.   KKkk
  19350. `7BE*^E
  19351. tpgvx
  19352.                                 
  19353.                                 
  19354.   KKkk
  19355. .`rFpxvwH
  19356. ?/VoK}
  19357.                             
  19358.                         
  19359.   KKkk
  19360.     2577
  19361.   KKkk
  19362.     2577
  19363.   KKkk
  19364.     2577
  19365. 3383'f@U
  19366. ?=6?.
  19367.   KKkk
  19368. 22JJhF
  19369. <KR"sbu
  19370. Na/__AL
  19371.     2577
  19372. ,,rG        
  19373. 6Thf.
  19374. |gg,,
  19375.   KukU
  19376.     2577
  19377.   KKkk
  19378. (XiG}
  19379. ~MXz}U5
  19380.     2577
  19381.   KKkk
  19382.     1,mWlj
  19383.     2577
  19384. {}\,"
  19385. ~QR~i3
  19386. NxzNz\
  19387. &6GGFSSSSSSSSSSSSS
  19388. M```uuuuuuuuuuuuu
  19389. WaWxzk/
  19390. ^`^^^
  19391. `&&\7
  19392. vxQ[6
  19393. 6??>?>?>?>?>>?>?>
  19394. 7rL>LL
  19395. '507,
  19396. pK5m}xs
  19397. %NkUk
  19398. #,Qa&
  19399. /xq_p9=
  19400.     2577
  19401. 7(((>8
  19402. sp_A?
  19403. S7&x`'&x3
  19404. %aWxr
  19405. %aWxO>
  19406. ?,?,??555,%%^^
  19407. {LNL{8LLN:L
  19408. k%kkWkxkkaaaxqq
  19409. 7L{hN
  19410. kxrxrxxr7k
  19411. q^qxaWxWxWx
  19412. r>``L
  19413.     2577
  19414. >>,,L
  19415. ,`LNL
  19416. L{{7{
  19417.     2577
  19418. LLL{L
  19419. Lkku4
  19420.     2577
  19421. ^{,>>rtL
  19422. LLNLL
  19423. LpLLLN
  19424.     2577
  19425.     2577
  19426. >LNL{NL
  19427. LNLLLL
  19428. 7NLr7
  19429. L{NLL
  19430. U4{qkk
  19431. xx444444LL
  19432. LLLLLNrL
  19433. LLLNLL
  19434. LNukux
  19435. ? >3477
  19436. xxax/
  19437. Wx44L6L>Lz
  19438.     2577
  19439. Lckk9
  19440.     2577
  19441. xrLL4>
  19442. N{{u%
  19443.     2577
  19444.     2577
  19445.         
  19446. !!! 3347
  19447. 7652    
  19448.     2577
  19449. Help_BackToMapSCRP
  19450. on mouseUp
  19451.   global gWChilitedBtn
  19452.   global gNAVcdev
  19453.   global gWCcd_or_bg
  19454.   --  global gNAVEpcotPath
  19455.   global gWCpath
  19456.   global gWCvoicePath
  19457.   global gWCmainMusic
  19458.   global gpathAudio
  19459.   clearIdleAlarm
  19460.   --play stop
  19461.   stop cd snd "main"
  19462.   send mouseLeave to cd btn (the short name of me)
  19463.   send mouseDown to cd btn (the short name of me)
  19464.   send mouseLeave to cd btn (the short name of me)
  19465.   send mouseDown to cd btn (the short name of me)
  19466.   send mouseLeave to cd btn (the short name of me)
  19467.   lock screen
  19468.   if gNAVcdev is "REMOTE" then
  19469.     hide cd bmp "Help_Remote"
  19470.   else
  19471.     hide cd bmp "Help_Touch"
  19472.   end if
  19473.   hide cd btn "Help_BackToMap"
  19474.   unlock screen
  19475.   enableNavBtn
  19476.   put "Help" into gWChilitedBtn
  19477.   if gNAVcdev is "REMOTE" then
  19478.     put "Background" into gWCcd_or_bg
  19479.     send mouseDown to bg btn "Help"
  19480.   end if
  19481.   start cd timer "alarmSelect" of cd "National" expire in 2100 ticks
  19482.   --play file (gNAVEpcotPath & gWCpath & gWCvoicePath & gWCmainMusic) nowait
  19483.   set the soundFile of cd snd "main" to 
  19484.      (gpathAudio& gWCmainMusic)
  19485.   set the bufferSize of cd snd "main" to 180
  19486.   set the playVolume of cd snd "main" to 100
  19487.   play cd snd "main"
  19488. end mouseUp
  19489. -------------------------
  19490. on dismissPopup
  19491.   global gWChilitedReg
  19492.   global gNAVcdev
  19493.   global gNAVEpcotPath
  19494.   global gWCpath
  19495.   global gWCvoicePath
  19496.   global gWCmainMusic
  19497.   send mouseLeave to cd btn (the short name of me)
  19498.   play stop
  19499.   lock screen
  19500.   if gNAVcdev is "REMOTE" then
  19501.     hide cd bmp "Help_Remote"
  19502.   else
  19503.     hide cd bmp "Help_Touch"
  19504.   end if
  19505.   hide cd btn "Help_BackToMap"
  19506.   unlock screen
  19507.   enableNavBtn
  19508.   put "Help" into gWChilitedReg
  19509.   if gNAVcdev is "REMOTE" then
  19510.     put "Background" into gWCcd_or_bg
  19511.     send mouseDown to bg btn "Help"
  19512.   end if
  19513.   start cd timer "alarmSelect" of cd "National" expire in 2100 ticks
  19514.   --play file (gNAVEpcotPath & gWCpath & gWCvoicePath & gWCmainMusic) nowait
  19515.   set the soundFile of cd snd "main" to 
  19516.      (gNAVEpcotPath & gWCpath & gWCvoicePath & gWCmainMusic)
  19517.   set the bufferSize of cd snd "main" to 180
  19518.   set the playVolume of cd snd "main" to 100
  19519.   play cd snd "main"
  19520. end dismissPopup
  19521. -------------------------
  19522. on mouseDown
  19523.   global gWCacceptMouseClicks
  19524.   clearIdleAlarm
  19525.   if gWCacceptMouseClicks is not "false" then
  19526.     do "show cd bmp" && quote & (the short name of me) & "_hilite" & quote
  19527.   end if
  19528. end mouseDown
  19529. -------------------------
  19530. on mouseLeave
  19531.   do "hide cd bmp" && quote & (the short name of me) & "_hilite" & quote
  19532. end mouseLeave
  19533. downregion
  19534. leftbutton
  19535. leftregion
  19536. rightbutton
  19537. rightregion
  19538. upregion
  19539. Decemberdata
  19540. ,{ssW
  19541. 66666
  19542. 66666666
  19543. 66666666
  19544. 66666
  19545. 66666666
  19546. 666666666
  19547. 666666
  19548. 6666666
  19549. 66666
  19550. 6666666
  19551. 666666
  19552. 2kpM6665
  19553. 6j296
  19554. 65pV9
  19555. 9jMj)
  19556. ^\{"66,p
  19557. qEqggq
  19558. qEqEq
  19559. 6pgjMM
  19560. ~9/Mv
  19561. )fMpoRv|6
  19562. 5!%)9
  19563. 69N\Mf
  19564. 66666
  19565. !N_|_9
  19566. !UOM9
  19567. 4447=
  19568. Gk447^
  19569. 66666
  19570. 66666
  19571. l)/)!|
  19572.     2547
  19573. N_NEw_NE
  19574. FN!59
  19575. 66666
  19576.     2257
  19577. !N_Md
  19578. wN_N2
  19579.         2577
  19580. 66666
  19581. fN!59
  19582. 66666
  19583. 6qtp{2(pww_59
  19584. !NENd
  19585. jN_N/
  19586. aV({f)
  19587. t\"{\M"N_MFNNF
  19588. 9(656
  19589.         2577
  19590. j{B/\Nt/
  19591. 5\M"5_gdNEg
  19592. 6666s9
  19593. 9_oo"
  19594. 9!Mvo
  19595. ~`Nfoo_
  19596. )!N_N!.
  19597. 66666
  19598. 66j9(((
  19599. 666666
  19600. 666666
  19601. FN!59
  19602. 6\BO9
  19603. ojw_N!!Nj
  19604. 66666
  19605. 4(())
  19606. 7()))
  19607. 5_Mvo
  19608. )!Ewpo
  19609. 95!N_{o
  19610. 6666666
  19611. 5!N_N!5
  19612. opN!)
  19613. 66556
  19614. w\5!M_5
  19615. ofMEo
  19616. 66666
  19617. .!!Mjo
  19618. 66666
  19619. 5!Njo
  19620. 5!N_N|M!9
  19621. 65666
  19622. 65666
  19623. j{{{{{{{
  19624. n{{{j
  19625. n{{{j
  19626. V{dN!!5
  19627. 66666
  19628. N%K^j
  19629. Z(>N4^
  19630. ^^^^^^^
  19631. od{EN!9
  19632. {{{nj{{{
  19633. j{{jj
  19634. 666666
  19635. 9    9/4
  19636. ($%4(
  19637. $9S%^
  19638. j%%?T
  19639. ^%4%{
  19640. %4%%\4%%y
  19641. %%%4%%%4
  19642. 666666
  19643. Nfwko
  19644. 99.!Nwqo
  19645. 9.!Nf`o
  19646. OT8+?
  19647. !5999
  19648. Oopwf|N\5
  19649. "N\No
  19650. dN\N"
  19651. 66667
  19652. 9!ENfo
  19653. 6666666
  19654. 3(((3(((
  19655. 6"ENjo
  19656. 5!|M~
  19657. n{{{{
  19658. 15.59
  19659. ^^^^j
  19660. 5_N!5
  19661. 666666667
  19662. j^^K4
  19663. 6666666
  19664. pN!!Nl
  19665. OFw_F
  19666. 66666
  19667. {%%%^
  19668. z$4%^
  19669. !N_Nd
  19670. wFNE:
  19671. 666666
  19672. 6_N_{
  19673. pN_N5
  19674. 6666676
  19675. {{j{{{
  19676. 6666666667
  19677. j^^^^^^4
  19678. j{{{{{{
  19679. 6{{{j
  19680. \Ky}4^
  19681. ^^^^^^j
  19682. ofN!!N!Mj
  19683. o    7j$
  19684. o    7{$
  19685. 66666
  19686. ((>>((:
  19687. (((((
  19688. 39)    (9)
  19689. (((>4(((
  19690.     (((7
  19691. >((7>
  19692. (((6>(()
  19693. )((>?(((    
  19694. ((74((7
  19695. !EN\o
  19696. qNEN.
  19697. )_NEg
  19698. ~NFN!
  19699. \{~9fN_)9
  19700. 66666
  19701. 9"{~w_)
  19702. j^^^^
  19703. 5_NNj
  19704. wENE9
  19705. 9_N/9_N/
  19706. 7j{{{
  19707. j{{jj
  19708. {{{nj{{{
  19709. 66666
  19710. j^^K4
  19711. ^^^j^^^
  19712. f)29!N~
  19713. %^KTH
  19714. 66666
  19715. ofN!)
  19716. =.7n%>
  19717. 66666
  19718. ~NEN!
  19719. (((3(((3
  19720. 3(((3(((
  19721. 5-)!!N!59
  19722. :!Nj`vo~
  19723. opw_!5
  19724. 56"Mwjo
  19725. gEN_)
  19726. 666676
  19727. 6t_tj9
  19728. ~M_N!
  19729. 66666
  19730. 65"9((
  19731. 9~g|w|fwpo~
  19732. 9Xw_N/
  19733. 9.N_wq
  19734. `_NN.
  19735. 9(9sM/
  19736. 9.Nfo
  19737. 56666
  19738. 6\t{\
  19739. !N_M!N_N
  19740. zRz{z
  19741. 6Fwst
  19742. zzzz    
  19743. 6FM\MF
  19744. 666j2o
  19745. OpN!69
  19746. z{zz(
  19747. &bqqq
  19748. j{/5fM
  19749. 9ft{w
  19750. d^Bf"
  19751. 200$5
  19752. oOpwF
  19753. zq(q(
  19754. B66"t6
  19755. "Mw\o
  19756. 9jFNt6MN\*MN\*
  19757. BBdhc
  19758. qqqqb
  19759. 0#0720
  19760. qqqqqqqqqqq
  19761. 6"jo9
  19762. 666jt
  19763. *"t\l~9(
  19764. 9\{\t_6
  19765. 666666
  19766. sQsQsQ
  19767. ssdso
  19768. z2/66
  19769. t\pvo(
  19770. ";""Q
  19771. 6*"f_tB~((
  19772. 8l,js
  19773. 66666
  19774. 66666
  19775. kkCq[``F)
  19776. os~~@>
  19777. "\t    F*6
  19778. 6B\F\:6
  19779. 6wjF\:6
  19780. ll{{}
  19781. 6M_t"{\B"
  19782. ;1111;1;1;
  19783. 6w((V{\%/{j
  19784. 666o(9(V6
  19785. j{{{{{{j
  19786. {{{{{j{
  19787. {{{{{
  19788. lll$l
  19789. (9(O[
  19790. 9((((j5
  19791. N%K^j
  19792. Z(>\4y
  19793. ^^^^^^^
  19794. ^^^^^^^
  19795. ^^^^^
  19796. 33so~
  19797. 566~9#(
  19798. qssao
  19799. B{V(#(zB
  19800. 665s9
  19801. 66666666
  19802. k%^^^
  19803. 1:494
  19804. "Baf&6
  19805. 66666
  19806. j(9((
  19807. 3g3g33
  19808. jo[j66
  19809. 3wllllj
  19810. 66666666
  19811. OT8+?
  19812. D`3$$
  19813. 4:5:6
  19814. DwwD$
  19815. "3"88
  19816. n^OZ3
  19817. 33ww"
  19818. 3$$,$
  19819. 33wDw
  19820. 3}wDw3$
  19821. 33$3w3
  19822. DwDwD
  19823. D`3w3D
  19824. wD3w3$3
  19825. lZZjj
  19826. w3wDwD
  19827. D$$$3$
  19828. DhDw3w
  19829. .:96:66
  19830. 3$$wD3
  19831. %%4%X4>3
  19832. Crx;m*
  19833. z^>Iz
  19834. IXXXX
  19835. d{L]^^o-
  19836. 45566
  19837. Dw3$`w3
  19838. 33aijo7
  19839. wwD,3
  19840. ??wwDw
  19841. }zII;
  19842. XI`Y3"
  19843. FYLd+
  19844. wDwDw
  19845. Dw335
  19846. `DhDDw
  19847. wwDw3"}
  19848. :5:66
  19849. j{{jn
  19850. j{{{{j
  19851. DD,wD
  19852. ww3ww$w3D
  19853. 33$wLw
  19854. j^^^^K%
  19855. 3$,$Dw3`DDw
  19856. 79.]":
  19857. 1;C"1
  19858. Dw3w3}`6
  19859. D`DDwD$$
  19860. q44X}
  19861. k4^jj^
  19862. \Kyy4^
  19863. w3,3w
  19864. DLw3D
  19865. D3$w3
  19866. D`3$,
  19867. Dw$DwD`3$wD
  19868. 6^^h(
  19869. 81?1?
  19870. `3ww3$w3wD
  19871. l}llfw
  19872. zzzzsz
  19873. ????1
  19874. hDD,D$D
  19875. DD$D,$D
  19876.     zzzs
  19877. 3hDDhD,D
  19878. Dw3Dw
  19879. |b]]]/
  19880. //*//
  19881. ///*/
  19882. ///////////
  19883. o    7j%
  19884. DwD`wD
  19885. ${#|a$||E
  19886. XI444848
  19887. }{ag""
  19888. 8>>w[SS
  19889. ?$$$E$
  19890. w3DwD
  19891. DDwDww"w
  19892. 33a@~
  19893. zziS)8
  19894. a$zxa|z;X
  19895. _QZ26
  19896. $zxa;9;;;;C
  19897. DwD,33
  19898. :0Z{}j"uj
  19899. zz`azx
  19900. ?1?1?
  19901. {{{{{{{
  19902. j{j{{{{
  19903. \%K%{
  19904. n{{{{{{{
  19905. da{```z
  19906. ww$D,$3
  19907. j^^^^^^^j
  19908. ^^^^^^
  19909. ^^^^^^^j
  19910. ????5
  19911. 3`D$$,
  19912. ,$$,3
  19913. Zjojd
  19914. {{{jj{{{
  19915. ;=?=?=
  19916. 3$D`D3,3$D
  19917. NE's    
  19918. 3$$$h
  19919. 3$`DD
  19920. Ib;"09
  19921. ?1?11
  19922. "3311
  19923. 3,$D`D
  19924. ??1;;?
  19925. ("bi999
  19926. ttjs*
  19927. h^K?(/
  19928. 3$3$w3D$$
  19929. st*/**
  19930. zz~b~d
  19931. `D`Dw$
  19932. st///*/*
  19933. /////*/*
  19934.         sz~
  19935. 1?1111
  19936. [t/^/!/*
  19937. 335&&k
  19938. ((2>(()
  19939.     (((7
  19940.     (((6:(()
  19941. 4((74((7
  19942. )((>6(((    
  19943.     zszz
  19944. 5dOv@":
  19945. qOF@":66
  19946. qqqqqqU
  19947. jzzu11
  19948. ?1?;?
  19949. :1?1?
  19950. r;:H:
  19951. bZFu":6666
  19952. D3D3w
  19953. fKBO-
  19954. 7 bvS@
  19955. 33f"w3D
  19956. lllgj
  19957. 3jabdb
  19958. >/.8>
  19959. "SZuS":6""
  19960. >b+t||y
  19961. 429Xz
  19962. ?????
  19963. a[atE
  19964. $5$1$
  19965. Szgu":5
  19966. ppnJYJnphP
  19967. }Hn}B
  19968.     zbsb
  19969. `LW5 
  19970. 1;19<220
  19971. L}}n1
  19972.  UC@`1
  19973. Ln}f"
  19974. qq1qqb!a
  19975. }u~~p
  19976. tqtq67
  19977. !T~gg-???
  19978. zecn}\
  19979. zzbbzb    T
  19980. A]CX#=
  19981. 3if`ccag
  19982. `|#;;3
  19983. ~k]]?~
  19984. tqYO?
  19985. 33D>3
  19986. zYD]Z
  19987.     lgag
  19988. suqO1>/
  19989.     XXag
  19990. ;;4    2
  19991. ooq>"
  19992. qs|1q
  19993. buOO 
  19994. XUXa|
  19995. qq|qq
  19996. 7WZWZWZP
  19997. 888$o
  19998. uO~O>"
  19999. h_o_oM_PPPPPW-;^Y-**999    9    
  20000. ;;;;;;;;
  20001.                 c
  20002.         c        
  20003. 22444422
  20004. "Wdpp
  20005. jojsu
  20006. O|@q~
  20007. 1bb"U
  20008. g4g~q
  20009. q~o~~
  20010. ~pqqb#qqj\
  20011.     ~~~~
  20012. Oq~O~o
  20013. {{ssssss
  20014. [INFO
  20015. Continue_hilitedata
  20016. h+BiO
  20017. CoverBadObjsdata
  20018. 111717
  20019. 1111177
  20020. 11171
  20021. :::::6:
  20022. 7777777177
  20023. 117177
  20024. piMiM
  20025. T`Mip
  20026. N>NW>
  20027. >7NNN
  20028. ,,((,,
  20029. 18..8.8
  20030. TipT\TT
  20031. Oa(+.(
  20032. otEO]
  20033. 626226(RyqR
  20034. u    Tb0
  20035. `{    b5
  20036. LZLZ(
  20037. ETAIL
  20038. ZINFO
  20039. ContinueSCRP
  20040. on mouseUp
  20041.   global gWChilitedReg
  20042.   global gNAVcdev
  20043.   global gNAVEpcotPath
  20044.   global gWCpath
  20045.   global gWCvoicePath
  20046.   global gWCmainMusic
  20047.   clearIdleAlarm
  20048.   play stop
  20049.   send mouseLeave to cd btn (the short name of me)
  20050.   send mouseDown to cd btn (the short name of me)
  20051.   send mouseLeave to cd btn (the short name of me)
  20052.   send mouseDown to cd btn (the short name of me)
  20053.   send mouseLeave to cd btn (the short name of me)
  20054.   lock screen
  20055.   hide cd grp "Months"
  20056.   hide cd btn "Continue"
  20057.   unlock screen
  20058.   enable cd btn "Trivia"
  20059.   put "Trivia" into gWChilitedReg
  20060.   if gNAVcdev is "REMOTE" then
  20061.     send mouseDown to cd btn "Trivia"
  20062.   end if
  20063.   --ring cd alarm "alarmSelect" of cd "National" at 2100
  20064.   start cd timer "alarmSelect" of cd "National" expire in 2100 ticks
  20065.   --play file (gNAVEpcotPath & gWCpath & gWCvoicePath & gWCtriviaVoice) nowait
  20066.   if the isplaying of snd "main" is false then
  20067. --    set the soundFile of cd snd "main" to 
  20068. --         gNAVEpcotPath & gWCpath & gWCvoicePath & gWCtriviaVoice
  20069. --    play cd snd "main"
  20070.   end if
  20071. end mouseUp
  20072. -------------------------
  20073. on dismissPopup
  20074.   global gWChilitedReg
  20075.   global gNAVcdev
  20076.   global gNAVEpcotPath
  20077.   global gWCpath
  20078.   global gWCvoicePath
  20079.   global gWCmainMusic
  20080.   play stop
  20081.   send mouseLeave to cd btn (the short name of me)
  20082.   lock screen
  20083.   hide cd grp "Months"
  20084.   hide cd btn "Continue"
  20085.   unlock screen
  20086.   enableNavBtn
  20087.   put "Trivia" into gWChilitedReg
  20088.   if gNAVcdev is "REMOTE" then
  20089.     send mouseDown to cd btn "Trivia"
  20090.   end if
  20091.   ring cd alarm "alarmSelect" of cd "National" at 2100
  20092.   play file (gNAVEpcotPath & gWCpath & gWCvoicePath & gWCmainMusic) nowait
  20093. end dismissPopup
  20094. -------------------------
  20095. on mouseDown
  20096.   cdbuttonDown (the short name of me)
  20097. end mouseDown
  20098. -------------------------
  20099. on mouseLeave
  20100.   cdbuttonLeave (the short name of me)
  20101. end mouseLeave
  20102. downregion
  20103. leftbutton
  20104. leftregion
  20105. rightbutton
  20106. rightregion
  20107. upregion
  20108. nPALT
  20109. Systemdata
  20110. efffuff3iff
  20111. af3f f33
  20112. -3ff-3f3-3f
  20113. d33fi333o33
  20114.  wwwiUUU"DDDt"""W
  20115. dTAIL
  20116. ICARD
  20117. Customdata
  20118. Help_BackToMap_hilitedata
  20119. >(()K
  20120. K=((>
  20121. :[[Fa
  20122. dYY==d
  20123. =='=d
  20124. u63Z=Y
  20125. 9/%Y4=%
  20126. 9~Y70
  20127. Y3?d^
  20128. ^x^^&2
  20129. -_    5%
  20130. 2|^^O 
  20131. oY^^i0
  20132. ^Y[n6[
  20133. YoZ^^
  20134. 0|_'^
  20135. Z4o0]
  20136. fo^9^Krd^[_
  20137. 8_8_9
  20138. ^9^^^`X
  20139. YOX`}X~XY`
  20140. Y`X]^
  20141. X `e`e`e
  20142. *TAIL
  20143. Y`X]^
  20144. XTMER
  20145. 10000, dummy
  20146. alarmGoBackSCRP
  20147. on timerExpired
  20148.   if the visible of cd btn "Continue" is true then  
  20149.     send dismissPopup to cd btn "Continue"
  20150.   else if the visible of cd btn "Help_BackToMap" is true then
  20151.     send dismissPopup to cd btn "Help_BackToMap"
  20152.   end if
  20153. end timerExpired
  20154. on dummy
  20155.   -- nothing
  20156. end dummy
  20157. 10000, dummy
  20158. alarmSelectSCRP
  20159. on timerExpired  
  20160. --  global gNAVEpcotPath
  20161.   global gWCpath
  20162.   global gWCvoicePath
  20163.   global gWCselectVoice,gPathAudio
  20164.   --ring cd alarm "alarmVoice" of cd "National" at 120
  20165.   start cd timer "alarmVoice" of cd "National" expire in 120 ticks
  20166.   --  play file (gNAVEpcotPath & gWCpath & gWCvoicePath & gWCselectVoice) nowait
  20167.   set the soundFile of cd snd "main" of cd "National" to 
  20168.       gPathAudio & gWCselectVoice
  20169.   play cd snd "main"
  20170. end timerExpired
  20171. ceSCRTMER
  20172. 10000, dummy
  20173. alarm_loseClicksSCRP
  20174. on timerExpired
  20175.   global gWCacceptMouseClicks
  20176.   put "true" into gWCacceptMouseClicks
  20177.   lock screen
  20178.   hide cd bmp "Wait"
  20179.   hide cd bmp "Copyright"
  20180.   hide cd bmp "WCcopyright"
  20181.   enableNavBtn
  20182.   unlock screen
  20183. end timerExpired
  20184. plaTMER
  20185. 10000, dummy
  20186. alarmVoiceSCRP
  20187. on timerExpired
  20188. --  global gNAVEpcotPath
  20189.   global gWCpath
  20190.   global gWCvoicePath
  20191.   global gWCmainMusic,gPathAudio
  20192.   --ring cd alarm "alarmSelect" of cd "National" at 2100
  20193.   start cd timer "alarmSelect" of cd "National" expire in 2100 ticks
  20194.   --play file (gNAVEpcotPath & gWCpath & gWCvoicePath & gWCmainMusic) nowait
  20195.   set the soundFile of cd snd "main" to
  20196.        gPathAudio & gWCmainMusic
  20197.   play cd snd "main"
  20198. end timerExpired
  20199. Gigi:POMOCD:Presenting OMO 
  20200. :exhibits:Audio:TchUSmix.aif
  20201. mainTAIL
  20202.  bkgd
  20203. ~~~~~~~
  20204. v``Q!"
  20205. <****
  20206. v``Q!"
  20207. 1111177
  20208. v``Q'$
  20209. vvxxvvv
  20210. vv``''$"
  20211. 0-08<
  20212. 117177
  20213. vvv~xv
  20214. ~~~~~
  20215. ~vxvv
  20216. pvvvvv
  20217. xxvvv
  20218. x~xvv~v~
  20219. v~vxx
  20220. xvxvv
  20221. vxvvv
  20222. ~~~~~~
  20223. 1!171717
  20224. vv``''11
  20225. 7(777(7'
  20226. vvvvv
  20227. 7717""
  20228. v```'11$
  20229. vvvvvvvv
  20230. vpvvvu
  20231. vvvvvvsv
  20232. vv`fpvvf``fv
  20233. >71'!!1771
  20234. ~~~~~~~
  20235. ~~~~~
  20236. 7!W``vvvvvvvvs
  20237. v`WW4"
  20238. !WWWv
  20239. --2--
  20240. ""'!`
  20241. vfRW4
  20242. "7!W``v
  20243. ""'/``p
  20244. xxxxx~~
  20245. "$'/`fpx
  20246. ~~~~~~
  20247. pvvvpvv
  20248. :(???
  20249. eGFH)
  20250. ??=8=
  20251. ==:?:
  20252. ?::?=:
  20253. ==8:?=8
  20254. y~if"
  20255. ??DF}F
  20256. 88:8=888=:8=8?=88
  20257. 8:??=8==8:::?=?===:8
  20258. :?:?===
  20259. ?=8:?===
  20260. ?:==?
  20261. ==???
  20262. ??????
  20263.     ppv`
  20264. p~cf&(:
  20265. =DFFD
  20266. :8:=88
  20267. 8=88==8=?::
  20268. ?=8:?8====:?===
  20269. ?:=:8?=
  20270. ???==
  20271. ?;?????
  20272. =8:88=:=8:8
  20273. 8:=8:?
  20274. 8:==8=::?
  20275. ?:=?88:=8?==
  20276. ?=8==
  20277. ::=?=:===
  20278. ?8==:=88
  20279. 8===:?8888?==:
  20280. :?888:
  20281. ???8=?8=88::?
  20282. ?=::=?=
  20283. ?==??8
  20284. ;;;;;?
  20285. ??????
  20286. 8888:=8??=
  20287. ?=?======:?:
  20288. :?:::8??
  20289. ???:???=??
  20290. ?==??
  20291. ???==
  20292.     ;;;;
  20293. 888:=8:==88=8
  20294. =8:?=
  20295. ?==:=8
  20296. ?8=?=
  20297. ?:=??
  20298. ?==?=??
  20299. ???=??
  20300. ??=??==?
  20301. ??===??
  20302. :==88
  20303. =8:==8:=8
  20304. 88?==88:8:==?:8::
  20305. =8?===?=:?
  20306. ????=??=
  20307. ?::??
  20308. ?8==?
  20309. =?=??
  20310. ?????
  20311. ~~~~~
  20312. ==88:=8
  20313. 8=8==8?::==?
  20314. :::?=8
  20315. ===?8?8:?
  20316. :?:?8
  20317. ?????????
  20318. 888=8
  20319. 888=8?::====8
  20320. =88:===??8?8:
  20321. ===8?=
  20322. =?8:8=88
  20323. 88::::
  20324. 88===888==??===8
  20325. ??????
  20326. yyBU;;
  20327. :?=:?=8:
  20328. ====:?
  20329. :=?=?=
  20330. }}}}}}}}
  20331. pp    {yt
  20332. ????=
  20333. ???;????
  20334.                         
  20335. :=?==:?:?===8?
  20336. :==8?8:
  20337. ???=?
  20338. }}}}}}
  20339. :?8===
  20340. :==8?8?=
  20341. }}}u}}
  20342. ?====
  20343. piMiM
  20344. T`Mip
  20345. =88=8
  20346. ==?:===
  20347. 8:?8====:==8====
  20348. u}}p    
  20349. ~~~~~
  20350. 88=88
  20351. =8?=88=?=
  20352. 4????
  20353. 4?????
  20354. ?????
  20355. ,/7{M]Mx
  20356. 5FC~s
  20357. aluZ'//
  20358. W$/'x
  20359. }}}}y}pu    
  20360. =yBBy;
  20361. //a{QC
  20362. 8==88888:::88
  20363. ??????
  20364. ==sF3
  20365. 8==88
  20366. :8888::8
  20367.     <lZ3
  20368. ==_y*
  20369. {~~~{~{
  20370. ?:==88
  20371. 88=8:88
  20372. III-III-I-F-I
  20373. ===1{*
  20374. ?=:88
  20375. 88=8888
  20376. ddddddddddd
  20377. ~~{{~~
  20378. 8=88888
  20379. Ydd~Y
  20380. dv[yr
  20381. ==d'Y~Y~d
  20382. ,,((,,
  20383. 8:8=888
  20384. fdf}t
  20385. =5?>?
  20386. fZ|d|Z|||
  20387. ~~~~~~
  20388. 18..8.8
  20389. TipT\TT
  20390. 8888:88
  20391. {~~~{~{~
  20392. Oa(+.(
  20393. otEO]
  20394. vvvxx~~~
  20395. 626226(RyqR
  20396. ;??-"
  20397. iiiii
  20398. iiiiqi
  20399. vvvvv
  20400. briri
  20401. vvvvxvv~v~~{{~
  20402. bu`u`
  20403. 29R99
  20404. 5B,N{nb
  20405. 5N,55N,5
  20406. @.}Y,B
  20407. Y77pl]z
  20408. lQ,J5
  20409. W:9'x
  20410. _:9'n
  20411. d;dQ,_
  20412. =$?4    
  20413. 84?8<4?
  20414. rFHS:$
  20415. 8++(J
  20416. D---d
  20417. "NLnq
  20418. u    Tb0
  20419. bbbeW
  20420. 5YuuE5
  20421. `{    b5
  20422. wuu`W
  20423. =d=~Y'
  20424. vvxx~x~
  20425. '''fb
  20426. 3''4 
  20427. !!'37
  20428. ==WQ?
  20429. =Yd=~YYi
  20430. ~~{~~~
  20431. 4:?=8
  20432. vvxvvv
  20433. LZLZ(
  20434. _XXr}
  20435. P8X`X8
  20436. ;?;?;;
  20437. vvxxv
  20438. ;;?;??
  20439. %vr}p
  20440. VgJ7F--
  20441. '7bbaN'<$
  20442. 7HUI7h
  20443.     +.[OW
  20444. {mpZ/9,
  20445. mea3CKO
  20446. nnjG;;?
  20447. JJnq$
  20448. '''{n{
  20449. !!!'P
  20450. `%<+@D\??
  20451. 4p'PPPPPP4'
  20452. ''''''P''
  20453. 44'PPPPPP4c
  20454. 5<9*xxxT&
  20455. <9&xxxP
  20456. #<6<#U~OhOE
  20457. s+1.1
  20458. ;?;?;
  20459. ???;;
  20460. R~rR-(
  20461. !cbc^+3
  20462. <vDb3O?qD@%
  20463. `~<6/-
  20464. ~gmh"914
  20465. @oI *?
  20466. %<++gJ
  20467. NPm$$7
  20468. "rxeF
  20469. yyyyyq
  20470. 77777
  20471. 6~;;1
  20472. 8HFii
  20473. <~;;1
  20474. *88N8N88888088*81"*""*
  20475. Jrr`J4+
  20476. ??3xD
  20477. ++3xD
  20478. <?.LNW
  20479. i`555
  20480. --sF-
  20481. %r,v+
  20482. GPPP`
  20483. rGP'C
  20484. ^[77?&r>-s
  20485. |aL&2
  20486. &Meo||oaL2++
  20487. |eL2++
  20488. CvL2..+
  20489. CvL2..+
  20490. eeL2?0
  20491. ,g^2+<
  20492. eoa=:2
  20493. &Maooooa?.++
  20494. |aL2++
  20495. PvL2..+
  20496. oa3.++
  20497. ~r-((
  20498. !?!?!!
  20499. }}}}y
  20500. {{{{`{`
  20501. ??5???
  20502. %%%'8'88
  20503. }}}y}
  20504. 4\]A|
  20505. `iAT(4        
  20506.         =DA
  20507. --^^ss^^P
  20508. (#WWc~
  20509. #\WO~
  20510. pr^#1
  20511. CV^ss~^Z0
  20512. cSWV(
  20513. -+^^`^
  20514. -~Rr,
  20515. ~~b~~->
  20516. )rRrr-(
  20517. (-~Rr-(("()-Rr-(
  20518. ,r~b~~~,
  20519. ~b~~-
  20520. X6V{{
  20521. RIMMMMI
  20522. ZTZZZT~
  20523. 5=T=i!i/=
  20524. "()))("
  20525. "()))(
  20526. ())))(
  20527. "))))(
  20528. ()-Z)(
  20529. }}}yy
  20530. 5=\5T5=55
  20531. (*::8
  20532. kqsO<&$
  20533. asOO6$
  20534. asO$6$
  20535. kasO$6$
  20536. WWsqOOW&
  20537. aasO.6$
  20538. aasO$6$
  20539. kasO$6$
  20540. kasO$6$
  20541. kasO$
  20542. 6W6&$
  20543. L{{{cc/
  20544. L{{7c//
  20545. LL{{7c//
  20546. }}}}}
  20547. LL{{{///
  20548. $6$kas$
  20549. LLL{7c///
  20550. A6W@xa
  20551. OWz4{cN
  20552. LL7{7/
  20553. .>QPhx
  20554. sWWgg0>
  20555. LL{{7c//
  20556. .>FFFFQY]lV
  20557. LL{{7c//
  20558. FFFFCQOYcl
  20559. <WWWk
  20560. sWWxGccL
  20561. )_lYx
  20562. pSIZ3>QIPw
  20563. LLL{{{7c//c
  20564. >FFFFQQ]{L{
  20565. %WWOk
  20566. sWW4Gcc
  20567. =3'Yclx
  20568. cfK\(+_''!x
  20569. aWW@)**'/
  20570. pxxw    
  20571. LLLLL{{7c//c
  20572. **>FIFFNF^Q_P__NlGpVpcEy
  20573. pw+KKQMr
  20574. Fp+o?
  20575. sWWK;**,/
  20576. {LL{{{{7c//c/////
  20577. vvvvv
  20578. LLLLL{{{{7c//c//c//c//c
  20579. ////////
  20580. 3W]yCC
  20581. s@WzGtcN
  20582. Lpc>    5&{
  20583. ISKmWWOk
  20584. sWWK8.
  20585. 0>C(}(H>HF\_yy
  20586. r\ssz}
  20587. ????=
  20588. ppspps
  20589. ~~$|t$}V
  20590.                     
  20591. ::::::::
  20592. <>>><
  20593. Z0FTx
  20594.                     
  20595.                     
  20596. IFFFX_vldG]}*
  20597.                     
  20598. :::::::
  20599. 0*8 1X
  20600. ss}}vv
  20601. ::::::
  20602. ExIxWIlO
  20603.                     
  20604.                                 
  20605. ::::::
  20606. OE]I]]II7EE%
  20607. ~~|pTu
  20608.                     
  20609.                     
  20610. %%%%%%
  20611. xOE]IIIIo
  20612. zlIxWElC
  20613. ?????
  20614. //////
  20615. ]IlCIJII9II]]EI;I
  20616. J;IElC
  20617. ?????
  20618.                     
  20619.                             
  20620. xCEIIIEElx
  20621. =**0*0
  20622.                     
  20623. COEI;EIlOr
  20624. ,>N-5
  20625.        &
  20626. /xOO/xOO
  20627. OWCx{cwL
  20628. Lcc>    &&{    +>&&0
  20629. ,*008
  20630. 8***,
  20631. cZZQ0
  20632. sOWW$
  20633. KCaam
  20634. :::::
  20635. 8>>6,
  20636. cMe..
  20637. uu[[.
  20638. urct00=4
  20639. 6Gy{d
  20640. ccccccc
  20641. ccccc
  20642. xLsss
  20643. 0RggmRRMMgM5
  20644.     yLAQ
  20645. $6$Osa
  20646. WWWWW
  20647. pLNI]L
  20648. CCmfc.
  20649. AEZZ*
  20650. $6$Osak
  20651. M*"5}
  20652. GALVZ
  20653. /$Osak
  20654. $$6</
  20655. >>>>>>>>>>0
  20656. $$6$ssakx;I
  20657. >7<>>2
  20658. &6$ssak
  20659. ]cccccc
  20660. ccccc
  20661. ccccccc
  20662. cccccc
  20663. U];">{{    
  20664. ....4
  20665. 4.+++MMMl>
  20666. WWWWW
  20667. WWWWWW
  20668. {>"]IU
  20669. I]/"{
  20670. {{g2"]]
  20671. I22>g{
  20672. +.7f/~p
  20673. {{1I5
  20674. 1.!!.
  20675. ~t~~~
  20676. >>>>>>>_>_>_
  20677. p~pp.
  20678. ;"&&    
  20679.     {&27{&2
  20680. MMie&$0>&$
  20681. *8!,ig~R",'
  20682. Uzc)RRg,,
  20683. 15//i
  20684. cI<]<]]]]]]]DIU;
  20685. 5KgYf
  20686. I(wwL">>>>    
  20687. >_>_>>>>>>>3>"
  20688. I9I/UI]]IwwL">>>>_
  20689. N>cwI<]IIU7UI]]](w{>">>>_
  20690. 0CC71
  20691. 8>w>LtwN>>>>I
  20692. >_>>>"{w(]]]II9IUI]](ww>N>
  20693. -]]]]
  20694. _>>>>>BwwI]]II5I9I
  20695. >>>>>Bww
  20696. ::::::
  20697. <W6.OOW&$66<
  20698. qsaak
  20699. ;>>;qs
  20700. OWz4{cN
  20701. cc>E&&{
  20702. 2&&.>
  20703. %iig}
  20704. $TTT{
  20705. ~~~i33
  20706. ::4::
  20707. Lpc>    5&{
  20708. *00CissiC[e
  20709. %iis}
  20710. mZTS5
  20711. C332WWWO
  20712. IIJEI;JEC
  20713. $$&<W
  20714. WWWWWWWWWW
  20715. WWWWWW
  20716. ]IEIIJElx
  20717. $$&$ssak
  20718. ElOIE
  20719. :::<:
  20720. $$6$ssk
  20721. IEI`O
  20722. :4::4::::<::
  20723. $$<ssak
  20724. 2<220
  20725. /0*0*=
  20726. :::::
  20727. ::<:::
  20728. :::::::
  20729. -----
  20730. ::::::
  20731. $$6$ssak
  20732. WWWWW]
  20733. :<:44
  20734. $$6$sqk
  20735. $<COa
  20736. :::4<:::44:
  20737. :44:::
  20738. $&<ssak
  20739. COsaaOCOOsk
  20740. xOEE%
  20741. sWWEN@W
  20742. 4:::::
  20743. 4::::
  20744. :<::::
  20745. $$6$ssqk
  20746. xOE]/EE
  20747. <4:4:
  20748. $$&<sOqa
  20749. CEE;EE]
  20750. $WWWW
  20751. <:4:<:
  20752. :::4:::44:
  20753. :4:4:
  20754. &6sOsak
  20755. I]IIE`C
  20756. ::4::<:
  20757. .26--
  20758. $6$ssak
  20759.     >U9"
  20760. :bo=97
  20761. s>>HHFN    
  20762. ::4::
  20763. $$6$ssqk
  20764. ::lQ{)&S
  20765. $$&<sO/
  20766. ::::::
  20767. >&/-/
  20768. $Ossa
  20769.     26-/
  20770. $$6OOssk
  20771.             {            {{{{{{{{
  20772. OOEIl
  20773. $6.Osaa
  20774. sWC4Gcw
  20775. LLpcnrN]
  20776. "*//a
  20777. 2&/--
  20778. $66OOsak
  20779. A]]]I9U9I9U999I9U9IUII]]]I]]///]//"2"222&2I
  20780. ,W_Y'
  20781. OOEEI
  20782. EE`CO
  20783. :<4::
  20784. :4::::4
  20785. $6$Ossak
  20786. ///]22"2222"
  20787. yg{{{{{{{{
  20788. OOEEI
  20789. EE`CO
  20790. ::4::
  20791. qqqqvqv
  20792. >&//-
  20793. $$6<OOsaa
  20794. </c/c/{{{{{{LLLLLL
  20795. 66&66&&&&&&
  20796. 15A4v
  20797. OOEEI
  20798. EE`CO
  20799. >&/--
  20800. $66OOssak
  20801. /<<<</c/c/c/c/w{{{{{LLLLL
  20802. OOEEI
  20803. EE`CO
  20804. $$6<OOsqak
  20805. /]x]]]]]-/-/-
  20806. <<<</c/c/c/c/wL
  20807. OOEEI
  20808. EE`CO
  20809. >&6--/
  20810. $&6$OOsaa
  20811. r%/%%%
  20812. zxzxzWCWCWx]x]]]]]]/-/-/
  20813. 2.pQ}v}}}}ss{
  20814. EE`CO
  20815.     1&/--
  20816. /%%%%%
  20817. xzxzxCCWCWx]x]x]]]]
  20818. }}}}s
  20819. (s-]lCO
  20820. >&6/--
  20821. /////
  20822. /%/%%
  20823. 8LL{7c7LL
  20824. 1&/]A
  20825. x]]]/
  20826. &&&&&&    &&&&&{
  20827. 0>C>v
  20828. s}ss{ss
  20829. &ZUU~Ws
  20830. ax]]xx
  20831. 88<888
  20832. :ffhfhhhhhh
  20833.     {{g    0
  20834. 22;;;"2/]IU;
  20835. &&    NccL
  20836. L{p>xOD
  20837. xWWs    &&
  20838. >&>qOWO
  20839. Cx{ssW&=2
  20840. 959I]];"2    g{
  20841. 74515
  20842. </w{LLL
  20843. /</c7{{LL
  20844. 1&/]--
  20845. </c/7{{LLL
  20846. >&&//--
  20847. /</c//{{{LLL
  20848. /</c//{{{{LL
  20849. EUOCCx]x]]/-
  20850. </c//{{{{LLL
  20851. ]]]]C
  20852. xzCCWx]]]/-
  20853. <</c<7{{{L
  20854. kaOW<
  20855. xzCCWC]]]/-
  20856. &&&&&&&&&]
  20857. -&&&&
  20858. &&&&&&
  20859. ksOCW<6
  20860. xzCCCx]]]-/
  20861. IxIlCCO
  20862. qsCW<$
  20863. zxOCCCxI]IIII7IIEEJIlIlC
  20864. asCWW&$
  20865. ! -&-
  20866. xCCOOoIII
  20867. asOWW6$
  20868. //{{{LL
  20869. rytwwh%&
  20870. -svrq
  20871. as$CW6$
  20872. ///{{{LL
  20873. WkasOsWWWWWI6$
  20874. PM`M0--
  20875. -**)--*_vvx
  20876. &&{qWW
  20877. /CWO^0$<
  20878. <>750{    
  20879. $>wcc
  20880. ><$$$$$$$
  20881. -------
  20882. I-t{N
  20883. ]k_-w{7
  20884. //]]]]]]x]xW]xW]lWCWCWCWOxzOxzOx2
  20885. <//c7{{LL
  20886. xx%%%%%%/
  20887. ]95>L
  20888. //////
  20889. -cccccA
  20890. >wI>>
  20891. wyltlhh
  20892. wtlphl
  20893. WWWWWWW
  20894. NIJJJJJIlIxIxIxIxIlCCCCCCCCCCx
  20895.  ;-vq
  20896. NlJoJoJlII]I]I]I]IIIIIIIIIIII7IIIIIIIIIIEIJJJJJJJJIlIkxII
  20897. &{I9{
  20898. /%/%%%%%%%%%%
  20899. OCCCCCCCCCCOlJoJoJoJoIIIN]II]
  20900. //////////
  20901. /%/%%%%%%%%O7E
  20902. ccccc
  20903. cccc>
  20904. WWWWWW
  20905. WWWWxWWWWW
  20906. WWWWWWW
  20907. ////////
  20908. zzmm+
  20909. &&&&&&
  20910. &&&&&&
  20911. &&&&&&
  20912. >&&qOWW
  20913. &&EGc/ccc/
  20914. $3E{ct
  20915. %y5E%/
  20916. >G{I]NtctG{t$
  20917. 83883
  20918. >II9ILU
  20919. cccccccc
  20920. !cccccc
  20921. ccc<cc/
  20922. +++2??LMaamo||v
  20923. {&&2I--IIp
  20924. >&{sOW
  20925. OWOO<&>>
  20926. /ccP;
  20927. >cc>>cc
  20928. ]w>>cw>
  20929. L{pc6382+
  20930. ]I959I]]2&g{g{
  20931. >II{wI
  20932. ,iYaU
  20933.     {{g7IIA
  20934. >&2^OWC/
  20935. sxWW$7
  20936. -/$5-/<Nc]{
  20937. ;;5ILwN>
  20938. >>>NII]-
  20939. fc$$2(
  20940. }yrly
  20941. 88848
  20942. 88888
  20943.     {{g>2;]]A99UI];6>g{{    
  20944. -$NLGN<]$
  20945. NE9{>>II/
  20946. ILwN>
  20947. >>>{wI]I9II]<;7
  20948. 8888888
  20949. "2;]IA
  20950. UI];62g{{{    -
  20951. UN55N
  20952. >>cw>
  20953. _>>>{wIII
  20954. II](w>>>_L7
  20955. 888888888
  20956.     {{g>2;]IA;U]]];&
  20957. >>>>c(]I]5IIIw{>>>_
  20958. 888888888
  20959.     {{g    26]]U-9UI];6>1
  20960. >>>>cwI]I]-I]IcN>>>
  20961. 888838888888888
  20962. 22;]IA
  20963. /CCCOzx
  20964. _>>>>cwI]I]/UI]IcN>>>
  20965. :4:42::7
  20966. 888888
  20967. 3:41888
  20968. -/]]xIlCOz
  20969. _>>>Nw(]]I]-II](cL">>>
  20970. 48888388
  20971. -]]]xIlCOz
  20972. >>>N{>{Lw(]]I9;I]](cN>>>_
  20973. 88888888888
  20974. :8888
  20975. 88888
  20976. 88888
  20977. <:1:1
  20978. ...6$$$$$
  20979. -]]]xIlCOz
  20980. >{;IN
  20981. >>>>>NwI]]-
  20982. ;II]](wL>>>_
  20983. 88888888
  20984. 8@YYA?&&>
  20985. "{{22{
  20986. 9IIEU
  20987. >wwc]9
  20988. <N>>_
  20989. 888888888
  20990. 8<<888888
  20991. 88:<>6
  20992. >6>6>66
  20993. ...6$$$$$
  20994. -]]]xCCCOz
  20995. >_>>>NI
  20996. 9I9I]](cw>
  20997. 888888888
  20998. 8<:4<16>6>
  20999. ...&$$$$
  21000. -]]]xIlCCCCWr
  21001. 7{>{>>
  21002. >_>>>>"NwwwI<]]I9;]](ww>N>>>_
  21003. <7LL8
  21004. <YYA}$&>
  21005.     2>2{
  21006. WO>>c{
  21007. ;IIIr
  21008. a>>>_
  21009. >wL>>wL>
  21010. ;CWWx
  21011. /xWOWLc{L
  21012. >>>>a
  21013. -I9Ip
  21014. pa>>>_
  21015. (/h\{m
  21016. 8:8>8<
  21017. .((.((.">&&&&&&&&&&$$$$$$$$$$$$
  21018. E]]]/NNI]U7UII]]]<(wwN>N>>>>_
  21019. pTKL=
  21020. 2$ysCW
  21021. CCWrwI<r>
  21022. izne%>8/
  21023. ."kaEI
  21024. "6.aCWO
  21025. %CWW]
  21026. ]www>
  21027. >wwwrwwwL
  21028. Lc/c/
  21029. 55(/mc{{
  21030. p*?%<
  21031. ]NN]]]<I"""".kwkwkkkkkk
  21032. xzxzxOCCCCCCx]xWE\
  21033. !II]]]<(ww>
  21034. 88888
  21035. ]]/N<]]]IIUI97]U]UINN]]]<I""k
  21036. zxzxzxWCCCCCl]xWIIIII]]/-/-/
  21037. /7B>>>>>__
  21038. 88888
  21039. kkkkkwk
  21040. 6"6"I/N<]]]I9
  21041. ]-/-/-/
  21042. $$$$$$$$$
  21043. 38888888
  21044. kkkap
  21045. $$$$$$$$$$$$6&6&.......
  21046. q*++2 92
  21047. /......
  21048. >I;I>
  21049. 88888
  21050. >>{I9L>
  21051. LLL{{7L
  21052. >>>>>
  21053. LL{{7c/c/<<
  21054. YMYMMM
  21055. LLLL{
  21056.     $$6$
  21057. -/]//&$<<--
  21058. {L{{7c<<<<
  21059. LLL{L7c
  21060. -/-//&0/
  21061. ;r{L7c<<<
  21062. /$$<    
  21063. LLL{{7<
  21064. Y[[[[^7-
  21065. MMMMMM
  21066. p~322
  21067. LLLL{{{7c/c/<<
  21068. -/-/&$<p
  21069. {LL{{{7c/c<<<<
  21070. >/-]/$$<    
  21071. Y[[[Y
  21072. &&&&&&&
  21073. 66UGcc
  21074. {{{{{{c/c
  21075. >-/-]//&$$<<    
  21076. >9I0    y
  21077. ]//&$$<        
  21078.     I99I7
  21079. ----/-////&$$0<    <    9
  21080. ;                
  21081. ppppp
  21082. 6666666666
  21083. 666666
  21084. 6666666666
  21085. 6666666
  21086. 6666666666
  21087. $$$]]
  21088. Ekk.kk
  21089. $$$$$
  21090. $$$$$$
  21091. kI]]]]
  21092. v777^
  21093. kIII<IAI.""k
  21094. MMMMMMMM
  21095. vvvvvvvvvvvvvv~~
  21096. 7[[Mp=32.
  21097. kkk%I]
  21098. (-/$cfj
  21099. kIawI
  21100. !mghc*;-(
  21101. I.I<]]E."k
  21102. <]]]]]-I
  21103. kIIU;]]]]]]]I/Ik
  21104. (((70
  21105. kk!kk.(]
  21106. k6I<I-I;I""kkkkkkkk]9IA
  21107. pppppp
  21108. ppq~qp~ppp
  21109. ~ppp~ppp~
  21110. pppq~q~~
  21111. p~p~~p~
  21112. y0<<E
  21113. ~pp~pppp
  21114. ~~~~~~~
  21115. ~~~pp~~p
  21116. pqpqpq
  21117. ~pp~~
  21118. pp~~~
  21119. pkkkwk
  21120. .""""""""I<]<//
  21121. 1$Q}HJ?
  21122. ;UI9r
  21123. pr]]5
  21124. ~~~~~
  21125. ~pp~~~pp~p
  21126. ](6"""""("
  21127. kkkkk
  21128. ~~~~~~
  21129. ~~p~~p
  21130. ~~~~~~~~~~
  21131. ~pp~~~pp
  21132. ~~~~~~
  21133. ~~~~~~~
  21134. ~~~~~~~~
  21135. ~~~~~
  21136. ~~~~~~~~~~~p
  21137. ss~&4
  21138. <$6...
  21139. &%wkwkkkk
  21140. ~~~~~~~
  21141. ~~~~p~
  21142. <>666>
  21143. $$$$&...
  21144. wNUI]]]("".k
  21145. <001=
  21146. ~~~~~~~~~~
  21147. .%(I<]]IIU5I9I]]]<(""
  21148. wkkkkk
  21149. ~~~~~~~~~~~~~~~
  21150. kkkkw
  21151. "(I<]]]IIU;UII]]](""(
  21152. ~~~~~
  21153. ~~~~~p
  21154. -9+++!
  21155. !!!!!
  21156. kkkkkw"""I<]]IIU;
  21157. ~~~~~~
  21158. ~~~~~~~~
  21159. 2++!!!
  21160. kkkkw
  21161. 63633
  21162. ~~~~~~
  21163. ~~~~p
  21164. >++-+!
  21165. ~~~~~~
  21166. ~p~p~
  21167. 4<!+!!!!
  21168. ~~~~~~~~
  21169. ~~~~~~~~~
  21170. ~~~~~~
  21171. trxhuutq
  21172. ->s^ss
  21173. 6334664
  21174. 36366
  21175. .H_dR!66.
  21176. e0y0A
  21177. ~~~~~
  21178. ~sss[`
  21179. yyye    
  21180. 63131613
  21181. yyye    
  21182. $0;;]]IU9;-IU
  21183. yyyyye    y    p
  21184. 34631
  21185. 7777772
  21186. sss``
  21187. y        00;;]]IU97-III]/;200    yeI
  21188. yyyyye    y    0000;;/]]]]IU9I9/
  21189. 77772
  21190. 1.1188
  21191. 8111.
  21192. p959III]/;20<    yyyr
  21193. U/]]]]IU9I999I9II]]]//;200
  21194. ;3363
  21195. ;6'3;
  21196. yyyy                        <0$$$y
  21197. <    yyyr
  21198. II]]]//;2000        y    rrryy            
  21199. 4363>6
  21200. ?W8!jtqq
  21201. qtvs**--
  21202. '5;)?
  21203. E<    0y
  21204. 333?3
  21205. 63166
  21206. I3<<<<<
  21207. ););)
  21208. <$$$$6&6&.......
  21209. 1?3313
  21210. 2272222277
  21211. <<0<<<
  21212. 664383
  21213. 42474722
  21214. 22272
  21215. 77-2227(
  21216. qttqs
  21217. 03;86
  21218. 200<+
  21219. 0--0-00
  21220. =11<<30
  21221. ---0--
  21222. <$$$$
  21223. $=2'+
  21224.     rrrr
  21225. 666$$666
  21226. ;$..$$$<.
  21227. ppppp
  21228. 222222222
  21229. *CM[^iv
  21230. 222272727
  21231. ppppp
  21232. 0222222
  21233. =CMM[i
  21234. 2222222
  21235. 66:26
  21236. 11111
  21237. qpppp
  21238. 7,=7<
  21239. 7<'<*
  21240. 708<*
  21241. >333<<
  21242. <111?
  21243. <<..$
  21244. 15;'5
  21245. 5555375
  21246. 9^m^i,8,<,',8
  21247. 1'*1<8
  21248. 31113
  21249. oioI/66
  21250. <$$=32?$fSRR"
  21251. 5,5,7'''';*,8
  21252. 550,;
  21253. 22222
  21254. 05585
  21255. 5''17
  21256. 4**713
  21257. 111*<1
  21258. 7<;18
  21259. 11111
  21260. -UmXU
  21261. <1'1<
  21262. vkK$6!
  21263. <<$0+%MMmT$/
  21264. 4'5*'
  21265. '7'*1*
  21266. 11111
  21267. ..22==LLM-
  21268. ||||||
  21269. v|q/66.
  21270. <$$?*=CViT*;-
  21271. 11*11
  21272. ?33>33
  21273. 33393333
  21274. <31>3>
  21275. 31;7;
  21276. n_66.
  21277. ckfT$%-
  21278. <$$33.2$
  21279. ciZT;
  21280. nX!6.
  21281. +.66"
  21282. hT$;-
  21283. -miiC?$$<
  21284. <<$6362!
  21285. ckmT;
  21286. hT$;-
  21287. /viq}$$<
  21288. fsiT;
  21289. wiTT/
  21290. ciZK;
  21291. ckZT;
  21292. -eii[
  21293. ckhT1
  21294. 23$cihA;
  21295. Xii^.
  21296. "ckfT$/
  21297. 111111
  21298. k666v2==rkTA
  21299. kfT1/-
  21300. W{iY+
  21301. k66$v2=_p[T;
  21302. -OTfh
  21303. jT*1/
  21304. 111*1
  21305. /1p[YM
  21306. ]P<6/G<6S%==l[AK
  21307. -1$ff~~
  21308. ~pfT$1-
  21309. =VkkV
  21310. %"Ti@T=2
  21311. &6<f&6%@=MTiA;
  21312. -'$$ffpp
  21313. XXXXX
  21314. =CtaV(
  21315.  =takV
  21316. %7ffk
  21317. =Ctt\(
  21318. =raaV
  21319. -%$ffj
  21320. *2 7+2/$
  21321. ^Y^^^^
  21322. XYXY^
  21323. ^Y^^^^
  21324. XYXY^
  21325. XXYXY^^XYX
  21326. XXXXX
  21327. Y^^Y^^Y
  21328. YXXY^^^^^^
  21329. YXXY^^^^^^
  21330. XXXXXX
  21331. _YXY_Y
  21332. _YXXY
  21333. _YXXY
  21334. dpppp
  21335. Y^^^^^^
  21336. Y^^^XY
  21337. Y^^^XY
  21338. Y^^^^
  21339. Y^^^^^^
  21340. Y^^^^^^^
  21341. Y^^^^^^^
  21342. nNxNnNNnN
  21343. ttpdhebo
  21344. .+=?231
  21345. s(cun
  21346. (c>c>
  21347. s(c>c>
  21348. )""-.
  21349. vvvvv
  21350. ttttdd
  21351. Id-HH--Hg-
  21352. 666Xn
  21353. d:XXY
  21354. 63  fwfA;
  21355. y)?X:
  21356. Rk[G;
  21357. SNHSSx
  21358. "=":2)6
  21359. =d=dY
  21360. uttqu
  21361. a2226:+-
  21362. e 2?8
  21363. s(c>c>c
  21364. .=.022>>>
  21365. a2226
  21366. de>=.
  21367. ppppp{
  21368. a>222
  21369. {{{p{
  21370. --I--
  21371. p{{pp
  21372. Yd=dd=dd
  21373. ==d==d=
  21374. wrrtrt
  21375. XY^XXX
  21376. 666$nnnt
  21377. `V<H*
  21378. {AtS/
  21379. PffkH~iV6
  21380. XXXXX
  21381. ptpp{{{
  21382. Y^^XYX
  21383. YY_Y^^
  21384. YY_YXX
  21385. Y^^^Y
  21386. -)$$ 
  21387. vvye666
  21388. =?)WjhF.8
  21389. BAobtk
  21390. lJ)$0
  21391. :6:::
  21392. XXnXn
  21393. P```E~xk/
  21394. 5ZXqq
  21395. <:9::
  21396. _Y_Y^^^
  21397. _Y^^^
  21398. ==7)pj`P48
  21399. jgxk/
  21400. Ps``0f
  21401. 2.^qrp
  21402. Qzdk/
  21403. s`}NNX
  21404. XXXXXX
  21405. 6'W[apuuph
  21406. upuup
  21407. Z/;14=1/[
  21408. ~5848
  21409. # &-fzbb
  21410. 1+[[ep
  21411. 34+8W~~i2
  21412. ~pdd!$6#
  21413. RZX/4
  21414. 4/ZKu@
  21415. 7Jnvl
  21416.     trt{t
  21417.  &--r{{x
  21418. ga\\*/
  21419. ="X`~~
  21420. uuu~u
  21421. 2-\Xqv
  21422. 66::                
  21423. :2'[aep
  21424. 5<[vqB2
  21425. 5+^X`
  21426. ~xx~s
  21427. qpdd! 0#
  21428. '##"fddp
  21429. @Oa//82                48//g
  21430. :7JOnl    
  21431.     *056
  21432. "::::::::
  21433. lqR^C2
  21434. 5"X`m~
  21435. sm@F3;
  21436. u~~u[
  21437. .....
  21438. 2)ZXqq
  21439. &_WWT52
  21440. g/144            
  21441.             ==/;
  21442. 55dQnn
  21443. :(6:6
  21444. w|rry
  21445. ~PPO/
  21446. $&&^`ss
  21447. 2._sqv
  21448. :<43    
  21449.     ++3:
  21450. 5.PWn\&32
  21451. !144            
  21452.                 =1/Z
  21453. d`5$.
  21454. ......
  21455. .:..$!.
  21456.     >3<:
  21457. rr#f((6:666
  21458. 6666666
  21459. A\dvvqkq
  21460. 2D_us
  21461. :63>    :    
  21462. up[[[+:
  21463. :"PPmX443
  21464. >->8>
  21465. 1=4=    
  21466.             41/1
  21467. rr`Z-
  21468. xuRT43
  21469. ddt|vvsh
  21470. }yrbh
  21471.     ~rdP
  21472. 888>8
  21473. 11111
  21474. 2DW_u
  21475. 6>44    >
  21476. {ppppp
  21477. 1>>--8>>>>>
  21478. ->>>8>>
  21479. !!#644
  21480. uuukkkkukkuuu
  21481. rrb(_ll
  21482. llllll`lnh{{w
  21483. 518>8+&8->
  21484. ->---^
  21485. >1>5>>-
  21486. ->---,>-
  21487. 5815    
  21488. >>>&>>
  21489. 8>851811
  21490.         158>>>>
  21491. 3:3        
  21492.             =444
  21493. ::::::
  21494. 5=)&v
  21495. pPAZ<
  21496. -0.))
  21497. <<**l
  21498. );)3);
  21499. 3))"dsv
  21500. (ZW}g
  21501. )!<))3&-&<
  21502. &)Z)<
  21503. $4?:63?+
  21504. ;n            
  21505. 9::::
  21506. }}o_E&)))).)8!
  21507.  $($$$$$2>LVvdXH2
  21508. $$$d9
  21509. svrvvs[
  21510. -|v0%
  21511. )))))
  21512. alltn
  21513. e_hed*
  21514. ?9?89
  21515. *<:::
  21516. <-84VX""Vh}P88v
  21517. 6262:22
  21518. 840`qh`
  21519. ns,++
  21520. nllvv
  21521. `Zrh{ll`l
  21522. <99::
  21523. ".**8*hrv0
  21524. 8084<0
  21525. :9::::
  21526. :8,Z&&
  21527. hha[335
  21528. 8::94
  21529. :<09    
  21530. lj`vvt
  21531. t{lnb#664
  21532. 2ltAZ
  21533. 2!&(6
  21534. ^Z#lvl#Z(6222:
  21535. 8""4-*8,
  21536. ul*bq
  21537. {{{p    3:
  21538. <6242
  21539. h(6#v"
  21540. 04604848&8^siilfdvl
  21541. (n(22
  21542. hl*8X
  21543. {tgh~^n
  21544. 22666222
  21545. l62266
  21546. rhXb-ThdV,`hhdX
  21547. 6;;2&
  21548. zzrlvvrl
  21549. lhZZ68
  21550. ::<6``hk
  21551. * +:9999
  21552. <::9:9::
  21553. xhbh"8:4
  21554. 26((h
  21555. {blyvl
  21556. lr-66(
  21557. lthb~
  21558. 999999
  21559. <:9<<59:5
  21560. 995<<<
  21561. 86:46:46
  21562. rvvnnnvlX
  21563. 666666
  21564. 3044?
  21565. 6222(72
  21566. 22((r
  21567. lnrlllv
  21568. 8686:
  21569. <:999
  21570. ::::>    
  21571. 8(8668(
  21572. 553&0
  21573. 9<:999
  21574. 4%66666422
  21575. 6ng[g
  21576. RXZ,688
  21577. 6ZdZ6,6(PPXZ
  21578. 6(llnrlr
  21579. z`hbhZ
  21580. ,888dXb0
  21581. <60488
  21582. nnvnl
  21583. !vrvlh#
  21584. qntntn
  21585. vtttn
  21586. >::3    
  21587. 66:(86
  21588. 2226(2
  21589. ::    ybhZdl#((
  21590. nnttvq
  21591. rtttttn
  21592. j#(-46(((666
  21593. 666226
  21594. tvr6(22
  21595. qqqqvqx
  21596. qsn0%8%4
  21597. nrthv
  21598. ,,6^z
  21599. 666266
  21600. (622222
  21601. :9:::
  21602. 22222
  21603. vqq}t
  21604. 0884%
  21605.     qqttqq
  21606. ryryr
  21607. rl626
  21608. 00-*n
  21609. sttttr
  21610. hqh~vkhq}vl
  21611. lyrll6
  21612. rrr(((lhlhhl
  21613. #llly
  21614.     346:
  21615. :<&3    
  21616. kj~x}|
  21617. lanry
  21618. `MPPPP\M0-
  21619. kg}`Pzz}
  21620. qqquks
  21621. ^"""3
  21622. 8Vbj*
  21623. -88860V*<88"6*8*
  21624. qhnhr
  21625. b`dhZn#n
  21626. lllhg
  21627. T_&&&"3
  21628. <<3:>8:
  21629. rrrZnrllrrrZlvbb
  21630. |a~bvhr
  21631. llXThn~`
  21632. <<3<<4*9
  21633. 9<03<&33
  21634. h_hhZ>((2
  21635. rrhlr
  21636. -0008
  21637. 8880n*<
  21638. ,lrhh
  21639. rrrrlr
  21640. stkknssknu
  21641. k["8%8%%0
  21642. 8%0-0
  21643. rrrrhbz
  21644.